ID: 1037108766

View in Genome Browser
Species Human (GRCh38)
Location 8:15141386-15141408
Sequence TCCAGGACATTCATGTAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 132}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037108766 Original CRISPR TCCAGGACATTCATGTAATA TGG (reversed) Intronic
903751058 1:25621062-25621084 TCCTGGACCTTCCTGTAAAATGG + Intronic
904025303 1:27499077-27499099 TCCAGTCTATTCATTTAATAAGG + Intergenic
914389339 1:147205061-147205083 TCCAGGACTTGCATGTAGTCTGG - Intronic
918445529 1:184613461-184613483 TCCAAGCTATTCATGTAACAGGG + Intronic
918861934 1:189839306-189839328 TCCAGGACATGATTGTCATATGG + Intergenic
921691906 1:218161742-218161764 TCCAGATCATTGCTGTAATAGGG + Intergenic
923966308 1:239143204-239143226 TCCAGCACATTCTTGTCATGAGG + Intergenic
924104705 1:240638486-240638508 TCAAACACATTCATATAATAAGG - Intergenic
1066445771 10:35481361-35481383 TCCAGGACATTCTTGGACTTAGG + Intronic
1067896239 10:50182829-50182851 TCAAGGACATTGATGTTATAGGG + Exonic
1069150847 10:64957656-64957678 ACCAAGACATTCCTTTAATATGG - Intergenic
1073127009 10:101157397-101157419 TCCAGCATCTTCGTGTAATATGG - Intergenic
1075333473 10:121592262-121592284 TACAGGGCTTTCATGTAAGAGGG - Intronic
1076211693 10:128652049-128652071 TCTAGTAAATTCATGGAATATGG + Intergenic
1076704944 10:132296278-132296300 GCCAGGAGACTCATGTAACACGG + Intronic
1086345247 11:85889699-85889721 TCCAGGAAAATCATGAAAGAAGG - Intronic
1087372138 11:97298364-97298386 TCCTAGACATCCTTGTAATAAGG - Intergenic
1087595258 11:100245484-100245506 TCAAGGCCATTCATATAATGAGG + Intronic
1090975292 11:131674829-131674851 TCCAAGACATGCATGGATTAGGG + Intronic
1092395596 12:8122614-8122636 TCCAGGAGATTGATCAAATAAGG + Intergenic
1092905558 12:13097741-13097763 CCCAGGGAATTCATGTAAAATGG + Intronic
1092964539 12:13628870-13628892 TCCAGGAAATTCAAGACATAAGG + Intronic
1093306385 12:17526187-17526209 TGCAGGAAATTGAGGTAATAAGG + Intergenic
1093704590 12:22260563-22260585 TCCAGATGATTCATATAATATGG - Intronic
1095174282 12:39073023-39073045 TCCAATTCAATCATGTAATATGG - Intergenic
1096607747 12:52778591-52778613 TCCAGGTCATTCTTATAATGCGG + Intergenic
1098136010 12:67402506-67402528 TCAAGTAAATTCATGTAACATGG - Intergenic
1102428698 12:112864729-112864751 TCCAGGACATTCATTTTCAAAGG + Intronic
1105533240 13:21239414-21239436 TAGAGGACATTCATTTATTAGGG - Intergenic
1108423166 13:50271406-50271428 TCCAGGCCAGTCTTGGAATAGGG + Intronic
1118985259 14:70748953-70748975 TCCAGGATATTCGTGAAAGATGG + Exonic
1125122263 15:36175926-36175948 GCCAGAACATTCATGTATAAGGG - Intergenic
1126760557 15:51966385-51966407 TTCAGGACAACCAAGTAATAAGG - Exonic
1126901031 15:53314371-53314393 TCCAGGACATTGAAGTTCTATGG - Intergenic
1129996604 15:80012047-80012069 TTCAGGAAATTCATGTAAACAGG - Intergenic
1131561868 15:93450961-93450983 TACAGGAAATACATGTTATATGG - Intergenic
1132297434 15:100750795-100750817 TCCAGCACATTCATTGAATAGGG + Intergenic
1135978139 16:27124639-27124661 GCCAGGACACTCATGGACTATGG + Intergenic
1137244012 16:46688559-46688581 TCCAGGAAATTCATGTAAGCAGG + Intronic
1137354860 16:47751608-47751630 TCCAGGACATTTAGGTCTTATGG + Intergenic
1140917347 16:79506237-79506259 TCCAGGACATACATCTGAAATGG + Intergenic
1156656234 18:39290689-39290711 TCTAACACATTCATGTAATGTGG - Intergenic
1156847090 18:41678688-41678710 TCCAGGATTTTCATGTTACAAGG - Intergenic
1158805543 18:60967598-60967620 TCAAGGACCTTCACCTAATAAGG - Intergenic
1159694955 18:71545413-71545435 TCAAGGACATTCATGACTTATGG - Intergenic
1162616774 19:11807917-11807939 TCCAGGACTCTCATGTGAGAAGG + Exonic
1163618157 19:18341555-18341577 TCCAGGAGATTCAGGGAAGAAGG + Intronic
1168572038 19:57478966-57478988 TCCAGGACATGCAGGCTATAGGG + Intergenic
926231703 2:11009187-11009209 TCAAGAACATTCATGTCAGAGGG - Intergenic
930045988 2:47173540-47173562 TTCAGGTCACTAATGTAATACGG - Intronic
931534443 2:63257481-63257503 AGTAGAACATTCATGTAATAGGG + Intronic
931544193 2:63362900-63362922 TTAAGGACTTTCATGTTATAGGG - Intronic
933309944 2:80648061-80648083 GACAGGACATTCCTGTACTAAGG + Exonic
935498588 2:103810751-103810773 TTCAGGACCTTCATGTAATCAGG + Intergenic
935503036 2:103865680-103865702 TACAGGACATTCAGTTAAAATGG - Intergenic
935546713 2:104407171-104407193 AGCAGGACATTCATGTTATAAGG + Intergenic
936896268 2:117431399-117431421 TCCAGAACTTTGATGTAATAGGG + Intergenic
939474388 2:142667930-142667952 TCCATGACCTTCATGAAGTACGG - Intergenic
939529284 2:143337040-143337062 TCCAAGACATGCAGGTAATCTGG + Intronic
943516217 2:188890647-188890669 TCTAGGACAAACATGTAAGATGG - Intergenic
943847126 2:192665172-192665194 ACTAGGACATTCATTTACTATGG + Intergenic
944818769 2:203407992-203408014 TCCAGGACAAACCTTTAATAAGG - Intronic
946229648 2:218283348-218283370 TCCAGGTCCTTCATGTTATGCGG + Intronic
946390056 2:219409668-219409690 TCCATGCCATTCATGAAATCTGG + Intergenic
1171022229 20:21596138-21596160 TCAAGGACATTCAAGTATTTTGG + Intergenic
1171429541 20:25072792-25072814 TTGAGGACATTCATGAATTAAGG - Intronic
1176954425 21:15084786-15084808 TCCAGGACATGCCTAGAATAAGG + Intergenic
1182038056 22:27214801-27214823 TACAGGACATTCATGTCTCAAGG - Intergenic
951609550 3:24477064-24477086 TCCAGGACATACATATAAAGGGG + Intronic
952052332 3:29399596-29399618 TTCAGGACATTGATGTAATCAGG - Intronic
956886579 3:73566036-73566058 TCCAGAGCATTCAGGTAATTAGG + Intronic
958790718 3:98647967-98647989 TTCAGGAAATTCATGAAAAATGG + Intergenic
960849137 3:122034354-122034376 TCCAGGATTTTCTTGTCATATGG - Intergenic
962169304 3:133083776-133083798 GACAGGACAGTCATGTAATTGGG + Intronic
963483635 3:145907114-145907136 TAAAGGACATCCAAGTAATAAGG - Intergenic
963868909 3:150392493-150392515 TCCAGGTAATGCATGTTATAAGG - Intergenic
973607585 4:52602965-52602987 TTCAGTACATTCATGGAATGGGG - Intronic
973743472 4:53940703-53940725 TCCAGCACATTTATTCAATAAGG - Intronic
974406018 4:61470712-61470734 AAGAAGACATTCATGTAATATGG + Intronic
974884371 4:67799395-67799417 TCCAGGACATTTATGTTCGATGG - Intergenic
976901201 4:90178663-90178685 TCCAGCATATTCATGTGGTATGG - Intronic
977690541 4:99903635-99903657 TCCAGAACATTCCTTGAATAGGG + Intronic
978714797 4:111828604-111828626 TCCAGGAGATTAACGTAAAATGG - Intergenic
979540750 4:121878609-121878631 TTCAGCACAATTATGTAATAAGG + Intergenic
984288481 4:177763433-177763455 TCCAGCACATGGCTGTAATAAGG + Intronic
985933790 5:3079456-3079478 TCTAGGACATTCATGTGACATGG - Intergenic
991279145 5:64891291-64891313 TCCAGGACTTTCAGGAAATGAGG - Intronic
995132495 5:108645141-108645163 TCCAGGAAAATCATGCAAAAAGG + Intergenic
995180637 5:109227413-109227435 TCCAGAAAATTCATCTAAAAAGG + Intergenic
996177873 5:120381233-120381255 TCCAGGAAATACATTTCATAAGG - Intergenic
1000464438 5:161558199-161558221 ACAAGGACATTCATGTAAGATGG - Intronic
1000902191 5:166924827-166924849 TCTAGGACATTTATGTGAAAGGG + Intergenic
1001680932 5:173556349-173556371 TCCAGGACGTTCATCTGATGGGG - Intergenic
1004002744 6:11610401-11610423 TACAAGACATTCATCTTATAAGG + Intergenic
1006239572 6:32665397-32665419 TCCAGGAGCTTCATGAAAAATGG - Intronic
1007975012 6:46092820-46092842 TTCAGGACATGGAAGTAATAGGG - Intergenic
1008690312 6:53971488-53971510 TCCAGAGCATTCCTGTAATGAGG - Intronic
1012045347 6:94265355-94265377 CCCAGGACATGCAGGGAATATGG + Intergenic
1015184085 6:130393697-130393719 TCCAGGCCCATCATGTAAAACGG + Intronic
1020355661 7:7272827-7272849 TCCAAGATATTCAAGAAATAAGG - Intergenic
1021712509 7:23429872-23429894 TCCAGGACTTACAGGTAATTTGG - Intronic
1023727732 7:43161892-43161914 CCCAGGACATTCATGGGAAACGG - Intronic
1024523280 7:50326379-50326401 TTCAGGACCTTCATCTAAAATGG + Intronic
1024977835 7:55130333-55130355 CTCAGGACATTCTTGCAATAGGG - Intronic
1025986839 7:66461050-66461072 TGCAAGTCATTTATGTAATAAGG + Intergenic
1026028170 7:66764366-66764388 TGCAAGTCATTTATGTAATAAGG - Intronic
1027210110 7:76139887-76139909 TGCAAGTCATTTATGTAATAAGG + Intergenic
1027811277 7:82902741-82902763 TCTAAGACATACATGTAGTAAGG + Exonic
1029159708 7:98542967-98542989 CCCAGGACACTCATATAGTATGG - Intergenic
1029265866 7:99339768-99339790 TTCAGCACTTTCATGTAATATGG - Intronic
1031369264 7:120945133-120945155 TCCAGCACATAAATGTAATCAGG - Intergenic
1033811250 7:145014683-145014705 TCCAGGACATTCTCTTATTATGG - Intergenic
1036970642 8:13351067-13351089 TAGAGGACTCTCATGTAATAAGG + Intronic
1037108766 8:15141386-15141408 TCCAGGACATTCATGTAATATGG - Intronic
1040759013 8:50814998-50815020 TTCAGCACCTTTATGTAATATGG - Intergenic
1041979504 8:63840748-63840770 TCCAGGATATTCATCAAATTCGG + Intergenic
1042361245 8:67885579-67885601 AACAGGACATTCATGACATAGGG - Intergenic
1044757387 8:95478738-95478760 TCCAGGATATGCAGGTATTATGG + Intergenic
1045782666 8:105886107-105886129 TCCAGAAAATTCATGGGATAGGG + Intergenic
1047522249 8:125603775-125603797 TCCAGGTCACTCATTTAGTAAGG - Intergenic
1048286501 8:133145922-133145944 GCCAGGACATTCTTTTAACATGG - Intergenic
1053590760 9:39512001-39512023 TGCAGGTCCTTCATGTGATAAGG + Intergenic
1054575544 9:66853288-66853310 TGCAGGTCCTTCATGTGATAAGG - Intergenic
1056462725 9:86823865-86823887 CCCAGAAAATTCAAGTAATAGGG + Intergenic
1056487129 9:87070653-87070675 TTAAGGTCATTCATGGAATATGG + Intergenic
1185669447 X:1794666-1794688 TCCAGGACATTCACTGAAGAGGG - Intergenic
1186226265 X:7402209-7402231 TCAAGGTCATTCAGTTAATAAGG + Intergenic
1188702085 X:33277538-33277560 TCCAGGGCATGCATCTCATAAGG - Intronic
1188856490 X:35202385-35202407 TCCAGAACATTCCTGGAATTTGG - Intergenic
1189416698 X:40821551-40821573 TCCAGGACAGTCAGATAATCTGG + Intergenic
1193847847 X:86496981-86497003 TCCAGAGCATTCCTGTAATGAGG - Intronic
1196623933 X:117856302-117856324 TCCAGTTCATTTATATAATAGGG + Intergenic
1199313781 X:146352125-146352147 CCCGGGAAATTCATATAATAAGG + Intergenic
1199517738 X:148697057-148697079 TCCAAAACATTCATTTTATAGGG - Intronic
1200684772 Y:6248270-6248292 TCCAGGACGTTCATGGCATTGGG + Intronic
1200990302 Y:9339535-9339557 TCCAGGACGTTCATGGCATTGGG + Intronic
1200992963 Y:9359850-9359872 TCCAGGACGTTCATGGCATTGGG + Intronic
1200995617 Y:9380128-9380150 TCCAGGACGTTCATGGCATTGGG + Intronic
1200998282 Y:9400474-9400496 TCCAGGACGTTCATGGCATTGGG + Intronic
1201000790 Y:9469006-9469028 TCCAGGACGTTCATGGCATTGGG + Intronic
1201003458 Y:9489338-9489360 TCCAGGACGTTCATGGCATTGGG + Intronic
1201006114 Y:9509620-9509642 TCCAGGACGTTCATGGCATTGGG + Intergenic
1201008772 Y:9529933-9529955 TCCAGGACGTTCATGGCATTGGG + Intronic
1201011348 Y:9550102-9550124 TCCAGGACATTCATGGCATTGGG + Intergenic