ID: 1037108834

View in Genome Browser
Species Human (GRCh38)
Location 8:15141964-15141986
Sequence CCAGGGTCTTCCACTGCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037108834_1037108842 12 Left 1037108834 8:15141964-15141986 CCTGTAGCAGTGGAAGACCCTGG No data
Right 1037108842 8:15141999-15142021 CTGCATCAAGAAAGCTCAATTGG No data
1037108834_1037108843 26 Left 1037108834 8:15141964-15141986 CCTGTAGCAGTGGAAGACCCTGG No data
Right 1037108843 8:15142013-15142035 CTCAATTGGAAAGACCGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037108834 Original CRISPR CCAGGGTCTTCCACTGCTAC AGG (reversed) Intronic