ID: 1037109755

View in Genome Browser
Species Human (GRCh38)
Location 8:15151962-15151984
Sequence GAATCACTTAATATCACGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 56}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037109755_1037109758 8 Left 1037109755 8:15151962-15151984 CCTGACGTGATATTAAGTGATTC 0: 1
1: 0
2: 0
3: 11
4: 56
Right 1037109758 8:15151993-15152015 TTAAAACTGTGGTTAAGCAAAGG No data
1037109755_1037109756 -3 Left 1037109755 8:15151962-15151984 CCTGACGTGATATTAAGTGATTC 0: 1
1: 0
2: 0
3: 11
4: 56
Right 1037109756 8:15151982-15152004 TTCAACAGCCTTTAAAACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037109755 Original CRISPR GAATCACTTAATATCACGTC AGG (reversed) Intronic
901110959 1:6794985-6795007 GAATTACTTAAAATCAGGTGTGG + Intronic
903104520 1:21063948-21063970 GAATCACTTGAGGTCAGGTCAGG - Intronic
905735804 1:40324997-40325019 GAATCAGTTGATATAACGGCCGG - Intergenic
908604082 1:65775123-65775145 GCATCACTTAATATTATGTTTGG + Intergenic
1064294167 10:14063091-14063113 AAAGCTCTTAATATCATGTCTGG - Intronic
1065255203 10:23859269-23859291 GAAGCACTTAATATTAAGGCTGG - Intronic
1066554993 10:36602425-36602447 GAATCACTTAATATGAGGATGGG - Intergenic
1068457971 10:57284464-57284486 AAGTCACCTAATATCACGTCTGG - Intergenic
1074573567 10:114647423-114647445 GAATCACATGATAGCACTTCAGG + Intronic
1074696699 10:116056259-116056281 GAATCACTTAACATCACATGAGG - Intergenic
1079192181 11:18288539-18288561 AAGTCACTTAAAATCAAGTCTGG + Intronic
1085346389 11:75770742-75770764 AAGCCACTTAATATCATGTCAGG + Intronic
1085854404 11:80160072-80160094 AAAGCACTTAATATAACGTCTGG - Intergenic
1086766409 11:90701224-90701246 GAGTCACTTAACATCACTGCAGG - Intergenic
1088141624 11:106623803-106623825 TAATTACTTAATATTACCTCTGG + Intergenic
1096442514 12:51656215-51656237 GCATCACTTAATAAAATGTCTGG - Intronic
1099556292 12:84111795-84111817 GAAACACTTAATATGATGACAGG + Intergenic
1101369031 12:104107941-104107963 GATTCTGTTAATATCAAGTCAGG + Intergenic
1131593807 15:93776055-93776077 GAATCACTCAATTTAACTTCTGG - Intergenic
1148596838 17:48863313-48863335 TAATCACTTAGTATCAAGTCAGG - Exonic
1149208462 17:54276633-54276655 GAATCTCTTAATATTACCTAAGG - Intergenic
1155869973 18:31015211-31015233 GATTAACTTAATTTCACATCTGG - Intronic
1158821819 18:61168678-61168700 GAAACACTTAATATCAGTCCCGG + Intergenic
1162543565 19:11314090-11314112 GAATCATATAATATCATGACTGG - Intronic
1163814591 19:19456712-19456734 TAATCACTTAATATCTCATCTGG + Intronic
927469132 2:23359257-23359279 GGATCACTTGAGATCAGGTCAGG - Intergenic
933610930 2:84434421-84434443 AAAGCACTTAATTTCACATCTGG + Intronic
938733248 2:134162758-134162780 GAAGCACTTAGCATCATGTCTGG - Intronic
939059787 2:137407463-137407485 GAATCATTTAATATCACTGTTGG + Intronic
941484655 2:166065225-166065247 GAAAAACTTAATAGCACTTCTGG - Intronic
1168919970 20:1523903-1523925 GAATGAAATAATATCATGTCTGG - Intergenic
1170130168 20:13010670-13010692 GCATCACTAAATATCAATTCAGG + Intronic
1170958604 20:21004165-21004187 GGAGCACTTAATAGCACTTCTGG + Intergenic
1172591336 20:36120158-36120180 GAATCACTTATAACCACGCCTGG - Intronic
1175003766 20:55659860-55659882 AAGTCACTTAAAATCACTTCAGG + Intergenic
952268431 3:31808917-31808939 GAATCAATTAATACCTCTTCTGG + Intronic
955426035 3:58790901-58790923 GAATTTTTTAATATCACTTCTGG - Intronic
956514380 3:70030494-70030516 GAATCACCTAATAGCATGTGTGG - Intergenic
957605907 3:82399371-82399393 GAATCAATTAATATTATTTCAGG - Intergenic
964099894 3:152976524-152976546 GAATGACTTGCTATCACTTCTGG + Intergenic
967962012 3:194933129-194933151 GAATCACTAAATATGAAGTGTGG + Intergenic
970916018 4:21336122-21336144 GATTCACTCAATATCATGTTTGG + Intronic
970968538 4:21954691-21954713 GAATCACTTATTATCTCATTAGG + Intergenic
981022775 4:140046707-140046729 GAATCACTTAAGATAAAGTAGGG + Intronic
983328192 4:166287592-166287614 GAATGACATAATATCATGTCTGG + Intergenic
984655335 4:182311128-182311150 GAAACACATAATATCACACCAGG + Intronic
984846280 4:184110629-184110651 GCATCACATCATATCCCGTCAGG - Intronic
995442186 5:112204295-112204317 GAATCACCTATTATAAAGTCAGG + Intronic
998446006 5:142198974-142198996 GAATCCCTAATGATCACGTCAGG - Intergenic
1010081740 6:71871659-71871681 GCATCTCTTAATATCACTTCTGG + Intergenic
1026967382 7:74448859-74448881 GAATCACTTAACATCAGGCCTGG - Intergenic
1030121025 7:106111526-106111548 GGTTCACTTAATAACACGTTAGG - Intronic
1030512221 7:110496814-110496836 GGATCACTTTTTATCAGGTCTGG - Intergenic
1033792283 7:144805127-144805149 GAATCACTTGATATCATCACTGG - Intronic
1035657573 8:1322112-1322134 TATTCACTTAATATCAAGTTGGG - Intergenic
1037109755 8:15151962-15151984 GAATCACTTAATATCACGTCAGG - Intronic
1037507669 8:19547980-19548002 GAATCACTTAATACAATGCCGGG - Intronic
1043914867 8:85910711-85910733 AAAGTACTTAATATCACGTCTGG - Intergenic
1047578081 8:126180459-126180481 GAATCACATCATATCACCTCTGG - Intergenic
1050313377 9:4375839-4375861 GAATGACTTACTATCACGACAGG - Intergenic
1052466359 9:28835261-28835283 GAATCACTTAACATCTGGTATGG + Intergenic
1053015695 9:34660744-34660766 GAATCAGTTAAAATCAAGTGGGG - Intronic
1055312740 9:75000672-75000694 CAATCAGCTAATATCATGTCAGG + Intronic
1057610986 9:96543598-96543620 AAATCTCTTAATATCAAGTAAGG + Intronic
1188158533 X:26772527-26772549 GCATCAATTTATATCACATCTGG + Intergenic
1190633040 X:52407282-52407304 GAAACAGTTAATGTCACATCAGG + Intergenic
1197151682 X:123227175-123227197 GAATCATTTAATGTCACTTAAGG + Intronic
1201590186 Y:15606081-15606103 GAATCACTTACAATCAATTCAGG - Intergenic