ID: 1037110302

View in Genome Browser
Species Human (GRCh38)
Location 8:15157778-15157800
Sequence TAGCATAGTTCAGCTAGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 62}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037110302_1037110309 30 Left 1037110302 8:15157778-15157800 CCTCCACTAGCTGAACTATGCTA 0: 1
1: 0
2: 0
3: 4
4: 62
Right 1037110309 8:15157831-15157853 TCTAAAAACAAATGTAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037110302 Original CRISPR TAGCATAGTTCAGCTAGTGG AGG (reversed) Intronic
902346305 1:15820651-15820673 TTCGATAGTTCAGCTAGTAGAGG - Intergenic
907689957 1:56653665-56653687 TCTCATAGTTCAGCTAATTGTGG - Intronic
923577875 1:235176835-235176857 TAGCAAAGGTCAGGCAGTGGAGG + Intronic
1063633668 10:7759472-7759494 TGGCATAGTAAAGTTAGTGGGGG - Intronic
1064976671 10:21124391-21124413 TATAATGGTTCAGCAAGTGGAGG - Intronic
1065604746 10:27405949-27405971 TAGCATGCTTCAGCTAGGAGAGG + Intronic
1066351176 10:34638388-34638410 TAGCATGGTTTAGCTAATTGGGG - Intronic
1071315639 10:84393847-84393869 TAGCATAGATGTGGTAGTGGAGG + Intronic
1074495502 10:113976785-113976807 TAGAATTGGTCAGCTAGTGGTGG + Intergenic
1085206468 11:74736093-74736115 AAGCTGAGTTCAGCCAGTGGTGG + Intergenic
1090236793 11:125154332-125154354 TAGGATAGATAAGCTGGTGGAGG - Intergenic
1094759614 12:33515760-33515782 TGGCGTAGTTCAGCTACAGGTGG - Intergenic
1109530691 13:63642119-63642141 TACCACAGGTCAGGTAGTGGAGG - Intergenic
1116763806 14:49046771-49046793 TGGCATAGTTCAGCCAAGGGGGG + Intergenic
1120970010 14:90199350-90199372 TAGCATACTACTGTTAGTGGTGG - Intergenic
1135148318 16:19983114-19983136 AAGCATAGTTGAGCTAGGTGAGG + Intergenic
1143984628 17:10901258-10901280 TAGCAAAGTTCACCAAGTGCTGG - Intergenic
1148395129 17:47302066-47302088 GGGCACAGTGCAGCTAGTGGAGG + Intronic
1148974835 17:51518535-51518557 TAGCCTAGTTTATCTATTGGTGG + Intergenic
1150302260 17:64056316-64056338 TAGCATGGCTGAGCCAGTGGTGG + Intronic
1150604397 17:66678530-66678552 TAGCATACTCCACTTAGTGGTGG + Intronic
1152057357 17:78040524-78040546 TAGAATATTACAGCTAGTGTTGG + Intronic
1152117268 17:78396198-78396220 TAGGATAGTTCAGCTTGGAGTGG + Intronic
1157124397 18:44942316-44942338 TAGCAGAGATTAGCTACTGGGGG - Intronic
1157599349 18:48884630-48884652 CAGCAAAGTTCAGCTCTTGGGGG + Intergenic
1158948906 18:62474125-62474147 TAGCATAGTCCTAGTAGTGGCGG - Intergenic
1164402304 19:27910669-27910691 TAGCATCGCTCTGCTGGTGGTGG + Intergenic
932357626 2:71079296-71079318 TACCATAGTTCAGCCAGTGAAGG + Intronic
932370084 2:71179548-71179570 TACCATAGTTCAGCCAGTGAAGG + Intergenic
935886362 2:107623847-107623869 TGGCAGAGTTCAGCTTCTGGTGG - Intergenic
936722981 2:115276006-115276028 TAGCATATTTCAACTCTTGGTGG + Intronic
936759021 2:115751492-115751514 AAGCAGAGCTCAGCTAGTTGTGG + Intronic
939153041 2:138495379-138495401 TGGCATAGTTCAGGCAGGGGAGG + Intergenic
940402252 2:153261598-153261620 CAGCATAGTCCAAGTAGTGGTGG - Intergenic
940893112 2:159054476-159054498 TAACCTTGTTCAGCAAGTGGAGG + Intronic
941528055 2:166630530-166630552 TAGAATAGTATAGCCAGTGGGGG - Intergenic
942312419 2:174667848-174667870 TAGCAGAGTTCAGCAGGAGGAGG - Intronic
947093656 2:226542178-226542200 TAGCATAGTGCAGCTTGTCAGGG + Intergenic
1173516730 20:43669586-43669608 AAGCAGAGTCCAGTTAGTGGTGG - Intronic
1174135656 20:48377235-48377257 GAGCATTGCTTAGCTAGTGGCGG - Intergenic
1175420179 20:58827000-58827022 TAACATAGTTCAGCCAGGTGCGG - Intergenic
1179049099 21:37873525-37873547 TAGCAATGCTCAGCTAGTTGTGG - Intronic
1184929321 22:47669277-47669299 GAGAATAATTCAGCCAGTGGTGG + Intergenic
960452974 3:117832780-117832802 TAGCAGAGTTCAGCTTGTTCAGG + Intergenic
963205935 3:142634562-142634584 TAGTATAGATAAGATAGTGGAGG + Intronic
974417674 4:61631008-61631030 TAGCATAGCTCAACTTGTGTTGG + Intronic
981581866 4:146257507-146257529 TAGGGTAGTTCAGCCAGTGCTGG - Intronic
988030573 5:25758284-25758306 TAGCACAGTTCAGCCAGTTCTGG - Intergenic
1008928525 6:56912643-56912665 ACGCATAGATCAGCAAGTGGGGG + Intronic
1009399690 6:63239617-63239639 GAGCAAAGTTCATGTAGTGGTGG + Intergenic
1012960216 6:105614548-105614570 TAGCATGGTTCAGATAATGAAGG + Intergenic
1022891626 7:34706906-34706928 TGGCATTGTGCAGCTAGTGTAGG - Intronic
1033031222 7:137829061-137829083 TAAAATAGTTCAGCTTGTGGTGG - Intronic
1037110302 8:15157778-15157800 TAGCATAGTTCAGCTAGTGGAGG - Intronic
1040444097 8:47476235-47476257 TAACAGGGTTCAGCTACTGGAGG + Intronic
1041725134 8:61011139-61011161 TACCGTAGTCCAGCTACTGGGGG + Intergenic
1041761210 8:61368509-61368531 TAGCATTGGTCAGATAGGGGTGG + Intronic
1052044335 9:23776703-23776725 TAGCATAGGTCAGGTAGAGAAGG - Intronic
1186564912 X:10652189-10652211 TATTATAATTCAGCTAGTGATGG - Intronic
1191224688 X:58030993-58031015 TGGAATTGTTCAGCTGGTGGTGG + Intergenic
1197634205 X:128896473-128896495 TGTCATACTTCAGCAAGTGGAGG - Intergenic
1199137704 X:144272593-144272615 TAGCATTGTTCAGAAAGAGGGGG + Intergenic
1200369896 X:155714584-155714606 CAGCACAGTTCCTCTAGTGGTGG - Intergenic
1200695912 Y:6359385-6359407 TAGCATAACTCAAATAGTGGAGG + Intergenic
1201023619 Y:9683606-9683628 TAGCATAACTCAAATAGTGGAGG + Intergenic
1201039365 Y:9815321-9815343 TAGCATAACTCAAATAGTGGAGG - Intergenic
1202199289 Y:22330127-22330149 TAGCATGACTCAGATAGTGGGGG + Intronic