ID: 1037110824

View in Genome Browser
Species Human (GRCh38)
Location 8:15162566-15162588
Sequence CCATAAGATAAGTGAAAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 231}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037110824 Original CRISPR CCATAAGATAAGTGAAAAGC TGG (reversed) Intronic
902557518 1:17255696-17255718 CCAGAAGATAAGTGACTAGAAGG - Intronic
908505850 1:64799249-64799271 CCATAAGAAAAAAGGAAAGCTGG - Intronic
908672678 1:66565325-66565347 ACATAAAATAAATGAAAATCAGG - Intronic
910836311 1:91516444-91516466 CCATAATCCAAGTGAATAGCAGG - Intronic
912076843 1:105885465-105885487 CTATAAGTTGAGTTAAAAGCTGG + Intergenic
912123328 1:106501657-106501679 AAGTAAAATAAGTGAAAAGCGGG - Intergenic
913164900 1:116176114-116176136 CCAACAGAGAAGTGACAAGCTGG + Intergenic
914427404 1:147590252-147590274 CCATAAAATTGGTGGAAAGCAGG - Intronic
917292770 1:173488468-173488490 CTAGTAGATAAGTGAAGAGCAGG + Exonic
917957143 1:180111119-180111141 GAATCAGATCAGTGAAAAGCAGG + Exonic
919421788 1:197378591-197378613 CCATGAGAGGAGTGAAAAACAGG - Intronic
919617914 1:199830535-199830557 CCATTAGACATGTGAAAAGAAGG - Intergenic
920816440 1:209338101-209338123 CCATGAGGTAAGTGCAAAGTTGG - Intergenic
921607020 1:217167624-217167646 CCTTAAGCTAAGTTAAAAGGAGG - Intergenic
922364354 1:224850257-224850279 CCAGATGATAAGTGTAAAGATGG - Intergenic
1063661655 10:8038273-8038295 AAATAAGATAAATGAAAAGGAGG - Intergenic
1064328015 10:14368577-14368599 ACATAAGACATGTGAAAAGATGG - Intronic
1064680715 10:17808771-17808793 GCAGAAGAAAAGTGAAAAGGAGG - Intergenic
1065073839 10:22056610-22056632 CCATGAAATAAGTGAAATTCTGG + Intergenic
1068115875 10:52736907-52736929 CTATAAGATAAATGAAATGATGG + Intergenic
1068924022 10:62516166-62516188 ACATAAGAAAGGTGAAAAGATGG - Intronic
1069008593 10:63346309-63346331 ACATAAGATAAATGAAGAGGAGG + Intronic
1069052031 10:63805055-63805077 CAATAAGATAAGAGGAGAGCTGG - Intergenic
1069381263 10:67845007-67845029 TCACAAAATAAATGAAAAGCAGG + Intergenic
1070363330 10:75712288-75712310 CGATAGGAAAGGTGAAAAGCAGG + Intronic
1071397046 10:85234470-85234492 CCAGAAGATTCATGAAAAGCTGG - Intergenic
1072032132 10:91530955-91530977 CCATGAGAGAAGTAAGAAGCTGG - Intergenic
1074341399 10:112633761-112633783 CCATAAAATAAGAGAAGAACTGG - Intronic
1074483781 10:113853995-113854017 CCAAAAGATAAGGGAGAGGCTGG - Exonic
1075155240 10:119970765-119970787 CCATCAGATAATTTAAAAGATGG - Intergenic
1075422502 10:122312612-122312634 CCATTAGAAAAGTGAAAGACTGG - Intronic
1077619243 11:3705127-3705149 GAAGAAGAAAAGTGAAAAGCAGG + Intronic
1080239254 11:30107417-30107439 CAATAAGTAAAGTGAAAAGATGG - Intergenic
1080529595 11:33161859-33161881 CCCCAAGAAAAGTAAAAAGCAGG - Intronic
1081264054 11:40997270-40997292 CTATAATATGAGTGAAAAGAAGG + Intronic
1082661393 11:55916355-55916377 CCATAAAATAATTGAAATGAGGG - Intergenic
1082769441 11:57195436-57195458 CCATGAGATAGGTGTAAAGCTGG - Intergenic
1084731064 11:71073977-71073999 CCATAAGATGCGTGAGGAGCCGG - Intronic
1084873652 11:72114903-72114925 CAAAAAGATAAGTAGAAAGCTGG + Intronic
1086282691 11:85209406-85209428 CCATAAGTTCAGAGAAGAGCTGG - Intronic
1087445633 11:98248767-98248789 CCATATGTTAGGTAAAAAGCAGG - Intergenic
1088722063 11:112601719-112601741 CCATAAGTAAAGTCAAAAGACGG - Intergenic
1091022297 11:132111412-132111434 GCACAAGATAAGTGAACAGAAGG + Intronic
1092369895 12:7908131-7908153 CCAAAAGAAGAGTGAAAAACAGG + Intergenic
1093869537 12:24271467-24271489 CCATAAAAAGAGTGAAAAACAGG - Intergenic
1095851165 12:46808353-46808375 CCATTATATAACTGAAAAGGTGG - Intronic
1096006827 12:48180262-48180284 CCAGAGGATAATAGAAAAGCAGG + Intronic
1097345825 12:58490918-58490940 CCATAAGATGAAAGAAAAGCTGG - Intergenic
1099714076 12:86267821-86267843 CCATATTATAAGTGAAAATCTGG - Intronic
1100113712 12:91276968-91276990 AAATAAGATAAGTGATTAGCAGG + Intergenic
1100841271 12:98614217-98614239 CAATAGGATAACTGAAAAACAGG - Intronic
1100870915 12:98909061-98909083 CCAGAAGATGAGTGCAGAGCTGG + Intronic
1105204800 13:18212016-18212038 CCATAAGAAAAATCAAAATCAGG - Intergenic
1105204984 13:18215046-18215068 CCATAAGAAAAATAAAAATCAGG - Intergenic
1105398533 13:20065496-20065518 CCATCAGGAAAGTGAAAAGGGGG + Intronic
1106946421 13:34832542-34832564 CCATAGATTAAGTGAAAATCAGG + Intergenic
1106946513 13:34833500-34833522 CCATAGATTAAGTGAAAATCAGG - Intergenic
1109508120 13:63333840-63333862 ACAAAAGATAAATAAAAAGCTGG - Intergenic
1110103448 13:71638635-71638657 CTAGAAGATTAGTGGAAAGCAGG + Intronic
1110966521 13:81705976-81705998 CCATAAGATAAAAGAAAACATGG - Intergenic
1111834183 13:93367128-93367150 CCAGAAGTTAGGTGAAAAACAGG + Intronic
1113422667 13:110182495-110182517 ACCTAAGAAATGTGAAAAGCAGG + Intronic
1115916647 14:38322224-38322246 CAAGAAGATAAGGGAAAATCTGG - Intergenic
1117330748 14:54709498-54709520 CCATGAGATAAGGGAAGAGTGGG + Intronic
1120464152 14:84834277-84834299 CTATAAGAATAGTGAACAGCTGG + Intergenic
1121001111 14:90452668-90452690 CCATAAGCTAAATGAATAGCAGG - Intergenic
1123134748 14:106017592-106017614 CCATAAGAGAAGGGACAGGCAGG - Intergenic
1124598175 15:31108876-31108898 TCAAAAGACAAGTGACAAGCTGG - Intronic
1125313558 15:38406899-38406921 CCATAAGATAAGGAGAAAGTTGG + Intergenic
1127200452 15:56642288-56642310 GCATAATATAAGTGAAATCCAGG - Intronic
1127318320 15:57818010-57818032 CCATGAGATAAGTGCTAAGACGG - Intergenic
1130392593 15:83472300-83472322 CAATAAGAGAAGGGAAAAGAAGG - Intronic
1133407997 16:5541400-5541422 CCCTAAAATAAGTGAAATCCAGG - Intergenic
1134155712 16:11841587-11841609 CCAGAAGATAACTGAAAAGTCGG + Intronic
1138174907 16:54888339-54888361 TAATAAAATAAGTGAAAAGCTGG + Intergenic
1139758790 16:69167495-69167517 CCATAGGATAAATGTCAAGCAGG + Intronic
1140948273 16:79791588-79791610 CCAGAAGCTAAGAGAAAGGCAGG - Intergenic
1142190309 16:88714377-88714399 CCACAGGACAAGTGAGAAGCTGG + Exonic
1145113801 17:20189417-20189439 CCATTTGAAAAGTGCAAAGCAGG - Intronic
1148702602 17:49598634-49598656 CAGTAAGATAAATGAAAAGTCGG + Intergenic
1149866081 17:60151775-60151797 CCATAAGATGAATGGAAGGCAGG - Intronic
1150850841 17:68702375-68702397 CCTTAAGAAAATGGAAAAGCTGG - Intergenic
1151000648 17:70371400-70371422 TTATAAGATAAATGAAAAGAGGG + Intergenic
1154308179 18:13245621-13245643 CCCTAAGACATGTGGAAAGCAGG + Intronic
1155392819 18:25353116-25353138 CCTTAAGATAAGGTAAAAGAAGG - Intergenic
1156664160 18:39385128-39385150 CCATAAGGTAATTGGAAAGGTGG + Intergenic
1156736454 18:40265718-40265740 CCATTAAAGAAGTGAAAAGTTGG + Intergenic
1156919970 18:42509857-42509879 CCAAAAGAAAACTGAAAATCAGG - Intergenic
1159007665 18:63026903-63026925 CCATCTGTGAAGTGAAAAGCAGG - Intergenic
1159864182 18:73685197-73685219 ATATAAGAAAAGTAAAAAGCTGG + Intergenic
1162840280 19:13351288-13351310 ACACAAGATAAATGAAAAACAGG - Intronic
1168075956 19:53981164-53981186 AGATTAGATAAGTGAAAGGCAGG + Intronic
925178024 2:1798476-1798498 CCATGAGATAACTGAGAAGTGGG - Intronic
925288127 2:2729231-2729253 TCATAAGCAAAGTGACAAGCAGG - Intergenic
928168200 2:28986207-28986229 CAATGAGATAAGTGACAAGCAGG - Intronic
928183207 2:29084683-29084705 CATTATGCTAAGTGAAAAGCTGG + Intergenic
928474276 2:31609772-31609794 CCATCAGGAAAGTGAAAAGATGG + Intergenic
932891990 2:75605463-75605485 CCAGAAGCTAAGGGAGAAGCAGG + Intergenic
933506684 2:83184846-83184868 CCAAAAGATATATGAAAAGGTGG + Intergenic
933845168 2:86319924-86319946 CCAGAAGATAAGAGAAAGGCAGG + Intronic
933860663 2:86463841-86463863 ACATAAGTTTTGTGAAAAGCTGG + Intronic
937048631 2:118869446-118869468 CCAAAAGAAAAGTGAAAGGCAGG - Intergenic
937791642 2:125968545-125968567 CCAGGAGATATGTGAAGAGCAGG - Intergenic
939010022 2:136835269-136835291 CCATAAAGTGAGTGAAAAGTAGG + Intronic
939488130 2:142842940-142842962 CAATAAGATAAGTGATCACCAGG + Intergenic
940903100 2:159144810-159144832 CAAGAGGATAAGTGAGAAGCAGG + Intronic
942579063 2:177396880-177396902 CCATGTGATAAGTAAACAGCAGG - Intronic
944044439 2:195392481-195392503 CCATAAAATTAGTGACTAGCTGG + Intergenic
944209799 2:197195274-197195296 CCATAAGATTAGGTAAAGGCTGG - Intronic
945585366 2:211654781-211654803 CCACAATATAGGTAAAAAGCAGG - Intronic
945941613 2:215956991-215957013 ACAGCAGGTAAGTGAAAAGCTGG + Intronic
945991914 2:216403231-216403253 CAATAAGAAATGTGAAATGCTGG + Intergenic
946146986 2:217738468-217738490 CCCTAAGGTAAGGGAAAACCAGG - Intronic
947596382 2:231414508-231414530 CCAAAGCATAACTGAAAAGCAGG - Intergenic
1169695533 20:8383350-8383372 CCAAAAGAAAAAAGAAAAGCAGG - Intronic
1169702169 20:8459016-8459038 CCATTAGACAATTTAAAAGCTGG + Intronic
1171223900 20:23424623-23424645 ACATAAGACAAGTTAATAGCAGG - Intergenic
1173393548 20:42656841-42656863 TCATATGATAGGTGAAAAGGGGG - Intronic
1173595350 20:44255599-44255621 CCAGCAAATAAGTGTAAAGCTGG + Intronic
1176105993 20:63387085-63387107 TTATAAGACATGTGAAAAGCAGG + Intergenic
1176712984 21:10271952-10271974 CCATAAGAAAAATCAAAATCAGG - Intergenic
1180760771 22:18202359-18202381 CCATAAGAAAAATCAAAATCAGG + Intergenic
1180760858 22:18203203-18203225 CCATAAGAAAAATCAAAATCAGG + Intergenic
1180760968 22:18205799-18205821 CCATAAGAAAAATCAAAATCAGG + Intergenic
1180764473 22:18237066-18237088 CCATAAGAAAAATCAAAATCAGG - Intergenic
1180764560 22:18237928-18237950 CCATAAGAAAAATCAAAATCAGG - Intergenic
1180771081 22:18386410-18386432 CCATAAGAAAAATCAAAATCAGG + Intergenic
1180774701 22:18418987-18419009 CCATAAGAAAAATCAAAATCAGG - Intergenic
1180774811 22:18421457-18421479 CCATAAGAAAAATCAAAATCAGG - Intergenic
1180774898 22:18422301-18422323 CCATAAGAAAAATCAAAATCAGG - Intergenic
1180807862 22:18730206-18730228 CCATAAGAAAAATCAAAATCAGG - Intergenic
1180807975 22:18734008-18734030 CCATAAGAAAAATCAAAATCAGG - Intergenic
1180829351 22:18892887-18892909 CCATAAGAAAAATCAAAATCAGG + Intergenic
1180829453 22:18894353-18894375 CCATAAGAAAAATCAAAATCAGG + Intergenic
1180829569 22:18896653-18896675 CCATAAGAAAATTCAAAATCAGG + Intergenic
1181070813 22:20338124-20338146 CCATAAGAAAAATCAAAATCAGG - Intergenic
1181070902 22:20338970-20338992 CCATAAGAAAAATCAAAATCAGG - Intergenic
1181193799 22:21166183-21166205 CCATAAGAAAAATCAAAATCAGG - Intergenic
1181193884 22:21167068-21167090 CCATAAGAAAAATCAAAATCAGG - Intergenic
1181193971 22:21167923-21167945 CCATAAGAAAAATCAAAATCAGG - Intergenic
1181215471 22:21324855-21324877 CCATAAGAAAAATCAAAATCAGG + Intergenic
1181215556 22:21325708-21325730 CCATAAGAAAAATCAAAATCAGG + Intergenic
1181215642 22:21326557-21326579 CCATAAGAAAAATCAAAATCAGG + Intergenic
1181525894 22:23486903-23486925 CCATAAGAAAAATCAAAATCAGG + Intergenic
1182914449 22:34016176-34016198 CCATAAGAGAACTGAAGAGGTGG - Intergenic
1203232917 22_KI270731v1_random:127574-127596 CCATAAGAAAAATCAAAATCAGG + Intergenic
1203233005 22_KI270731v1_random:128448-128470 CCATAAGAAAAATCAAAATCAGG + Intergenic
1203279441 22_KI270734v1_random:118192-118214 CCATAAGAAAAATCAAAATCAGG + Intergenic
1203279543 22_KI270734v1_random:119658-119680 CCATAAGAAAAATCAAAATCAGG + Intergenic
1203279660 22_KI270734v1_random:121925-121947 CCATAAGAAAATTCAAAATCAGG + Intergenic
949711462 3:6875676-6875698 CAATAAGCTAAGTTATAAGCAGG - Intronic
950240308 3:11363894-11363916 CTCTGAGATAAATGAAAAGCGGG + Intronic
951476940 3:23117237-23117259 GCATAAGATTACTGAAAAGTAGG - Intergenic
951772663 3:26276054-26276076 CCATACCATAAGTTACAAGCAGG + Intergenic
951999409 3:28768534-28768556 CCATTAAATAAGTTTAAAGCAGG + Intergenic
952210961 3:31228816-31228838 TCAAAAGATAAATGAAAAGGAGG + Intergenic
953398930 3:42595533-42595555 TCATAATTTAAGTGAAAGGCTGG - Intronic
953594192 3:44292640-44292662 CAATAAAAAAAGTGAAAAGCTGG - Intronic
954967933 3:54627348-54627370 CCATATGAGATGTGAAAAGTGGG + Intronic
960254598 3:115498676-115498698 CAAGAAGAGAACTGAAAAGCTGG + Intergenic
962615459 3:137122054-137122076 CCCTAAGAGAAGGGCAAAGCTGG + Intergenic
965345177 3:167540022-167540044 CCATGAGACAGGTGAAAAACTGG + Intronic
966875731 3:184320593-184320615 CTATAAGATGAGTGGGAAGCAGG - Intronic
968182829 3:196609890-196609912 GCATAAGGGAAGGGAAAAGCTGG + Intergenic
968314347 3:197710298-197710320 CCATAAGAAATGTCAAAAGACGG + Intronic
968495468 4:912998-913020 ACACAAGAAAAGTCAAAAGCAGG + Intronic
969990569 4:11258182-11258204 CCAAAAGATATATGAAAAGATGG + Intergenic
971853714 4:32016900-32016922 CAATAAGACAACTGAAAAGAGGG - Intergenic
974513421 4:62875172-62875194 ACAAAAGATCAGTGAAAAGTTGG + Intergenic
976318535 4:83685477-83685499 CCATAACATATGTGAGAAACAGG + Intergenic
978455825 4:108890308-108890330 CAATGAAATAAGTGTAAAGCTGG - Intronic
978620309 4:110630311-110630333 CCATAAGTTAACTTAAAATCAGG + Intronic
979356751 4:119714011-119714033 CAAAAATATAAGAGAAAAGCAGG + Intergenic
980193417 4:129556157-129556179 CGATAAGATTAGTGAGAAGGAGG + Intergenic
985007829 4:185551794-185551816 CAATCAAATAAGTGAGAAGCTGG - Intergenic
986891458 5:12313150-12313172 ACATAAAATAAGTGATAAGAAGG - Intergenic
987439250 5:17935770-17935792 CCAAAATATAAATGATAAGCAGG + Intergenic
988445889 5:31285419-31285441 TCACAAGGTAAGTAAAAAGCTGG - Intronic
990430567 5:55731340-55731362 CCAAAAGACAAATGAAAAGCTGG - Intronic
991275924 5:64846067-64846089 GCATAATATAATTGAAATGCCGG + Intronic
991348501 5:65695264-65695286 CAATAAGATAAGAAATAAGCAGG + Intronic
991419809 5:66429395-66429417 CTTGAAGACAAGTGAAAAGCTGG - Intergenic
992534584 5:77686186-77686208 CCAGAAGCTAAGAGAAAGGCAGG - Intergenic
994312754 5:98294443-98294465 CAATAAGATAAGAGAAAGGAAGG + Intergenic
994634876 5:102332353-102332375 CAATAACATCAGTGAAAAGCTGG - Intergenic
994888095 5:105592738-105592760 CTTTAAGATAAGTGAAAATTTGG + Intergenic
997059200 5:130479890-130479912 CCATGAGACAGGTGAAAAACAGG - Intergenic
999152901 5:149438333-149438355 CCAAAAGATATGTCCAAAGCTGG - Intergenic
1000899164 5:166892358-166892380 CCAAAAGATAGGTGGAGAGCAGG - Intergenic
1001452102 5:171834800-171834822 CCAAAAGATAAGACAAAAGAAGG + Intergenic
1003013024 6:2444221-2444243 CCAAAAGAAAAATGCAAAGCTGG - Intergenic
1006212186 6:32405287-32405309 CTATAAAATAAGTGAAAAAGAGG + Intronic
1006371443 6:33646463-33646485 CTATAAGAAAAGGGAAAATCTGG - Intronic
1007200361 6:40102891-40102913 CAATAAGCTAAATGAAAAGCTGG - Intergenic
1008235469 6:49042053-49042075 CCATGAGATAATTGACAAGCTGG - Intergenic
1010602398 6:77846226-77846248 CAATAAGAAAAGTGAAATTCAGG - Intronic
1013840822 6:114391617-114391639 CCATAAGCTTTTTGAAAAGCAGG - Intergenic
1014527633 6:122519928-122519950 CCAACAGTTCAGTGAAAAGCTGG - Intronic
1016241718 6:141939171-141939193 CCAGGAAATAAGTAAAAAGCAGG + Intergenic
1016521767 6:144954346-144954368 CCTTGAGATAAGTGAATGGCTGG + Intergenic
1018700026 6:166419106-166419128 TGATGAAATAAGTGAAAAGCAGG + Intronic
1019407573 7:891764-891786 CCGTGACTTAAGTGAAAAGCTGG + Intronic
1020836929 7:13165259-13165281 CCATGAAATCAGTGAAAGGCAGG + Intergenic
1022279056 7:28887619-28887641 CCAAAAGATAACTGACAAACTGG + Intergenic
1023176615 7:37441627-37441649 CAATAAGATAAATGAAATGAGGG - Intronic
1023466548 7:40462134-40462156 CCAGAAGTTAAGTGTGAAGCTGG + Intronic
1028091597 7:86709369-86709391 CTATAAGATGAGTGATTAGCTGG - Intronic
1028587228 7:92464298-92464320 CCATTAGATAATTGAAAATACGG + Intergenic
1028818564 7:95178570-95178592 ACAAAAGATAAATGAAAAGTTGG + Intronic
1028841287 7:95432536-95432558 CCTTAAGATTAGTGAGAAGGGGG + Intronic
1030289383 7:107857179-107857201 CAACAAGACAAGTGAAAAACAGG + Intergenic
1030577669 7:111310378-111310400 ACATAAGATAAGGGAAACGTAGG + Intronic
1031180164 7:118404156-118404178 TCATAAGACAAATGTAAAGCAGG + Intergenic
1034845792 7:154443271-154443293 CACTAAGAGAAGAGAAAAGCAGG - Intronic
1037110824 8:15162566-15162588 CCATAAGATAAGTGAAAAGCTGG - Intronic
1039312762 8:36336741-36336763 CCATAAAAGAATTGATAAGCAGG + Intergenic
1039477515 8:37847881-37847903 AAATAGGAAAAGTGAAAAGCTGG + Intronic
1042774291 8:72412758-72412780 CAATAAGAAAAGTAAAAAGTAGG - Intergenic
1043689389 8:83131692-83131714 CCAAATGATAGGTGAAAAGATGG - Intergenic
1044924634 8:97199759-97199781 CCAGGAGGGAAGTGAAAAGCAGG + Intergenic
1045812716 8:106242344-106242366 CCATAAATTATGTGAATAGCAGG + Intergenic
1045933664 8:107655398-107655420 CCAAAAGATAAGTCACAAACTGG + Intergenic
1046477907 8:114772853-114772875 CCATAAAAAAACTGAAAACCTGG + Intergenic
1048598329 8:135890656-135890678 CTCTAGGATAAGTGAAAACCTGG - Intergenic
1048663000 8:136628301-136628323 ACATAAGATGAGTGAACATCTGG - Intergenic
1051113918 9:13672909-13672931 CCTTAAGAGAAGTGGAAAGCTGG - Intergenic
1051162016 9:14219589-14219611 CCATAAAATACGTGTAAAGCAGG - Intronic
1051676256 9:19561306-19561328 CCATAAGATAAGTGAAAAAGAGG + Intronic
1052964795 9:34331762-34331784 CCATAAGATAAATGAACAGATGG - Intronic
1053505569 9:38640773-38640795 CCAGAAGCCAAGTGGAAAGCAGG - Intergenic
1054876588 9:70103679-70103701 CCATAAAAAAGGTGAAAAGACGG + Intronic
1054914148 9:70480385-70480407 CCAGAAGAAAATAGAAAAGCTGG + Intergenic
1055258711 9:74406203-74406225 CTTTAAGAAAAATGAAAAGCAGG - Intergenic
1055377701 9:75667870-75667892 AAAAAAGACAAGTGAAAAGCTGG + Intergenic
1055672982 9:78625809-78625831 CCATAAGGTAAGTGGAAATACGG - Intergenic
1060365290 9:123006123-123006145 CTAAAAGATAAGTGACAAACTGG - Intronic
1060953202 9:127618248-127618270 CCAAATTATAAGTGGAAAGCAGG + Intronic
1187218938 X:17305054-17305076 ACAAAAGATAAATGAGAAGCTGG - Intergenic
1188172201 X:26941351-26941373 CCAAAAGAGAAGAGAAAAGGAGG - Intergenic
1189068697 X:37840274-37840296 ACAAAATATTAGTGAAAAGCTGG + Exonic
1190172743 X:48124631-48124653 CCAAAAGAAAAGTGACAGGCTGG + Intergenic
1190179847 X:48182907-48182929 CCAAAAGAAAAGTGACAGGCTGG - Intergenic
1190224768 X:48536704-48536726 CCCTATGATAAATGAAAAGCAGG + Intergenic
1193025017 X:76837701-76837723 GCAGAAGGTAAGGGAAAAGCAGG + Intergenic
1193428316 X:81368358-81368380 CTATAAGCTCAGTGAAAAACAGG - Intergenic
1193505793 X:82342143-82342165 CCATAGAATAAGTTCAAAGCAGG + Intergenic
1193946514 X:87742597-87742619 CCATAAGAAAAGTAAAATGAAGG - Intergenic
1194669638 X:96714831-96714853 CTATAAGATAGCAGAAAAGCTGG + Intronic
1196760558 X:119197319-119197341 CCTTTAGATAAATGAAAACCCGG - Intergenic
1198731625 X:139736723-139736745 CCATAAGACATGTAGAAAGCAGG + Intronic
1201054183 Y:9972082-9972104 TCATAAGAAAAGTGATAACCTGG + Intergenic