ID: 1037115427

View in Genome Browser
Species Human (GRCh38)
Location 8:15220450-15220472
Sequence AAGCAGTTAGAAATGGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 263}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037115427_1037115433 9 Left 1037115427 8:15220450-15220472 CCTTGCCCCATTTCTAACTGCTT 0: 1
1: 0
2: 3
3: 39
4: 263
Right 1037115433 8:15220482-15220504 TGATTAAAATCAGAGATAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037115427 Original CRISPR AAGCAGTTAGAAATGGGGCA AGG (reversed) Intronic
901221933 1:7588242-7588264 AGGCAGTGAGAACTGGGGCGGGG - Intronic
901456027 1:9363370-9363392 AACCAGTTAGGGATGGGTCATGG - Intronic
902007415 1:13243342-13243364 AAGAACTTTGAAATGTGGCAGGG - Intergenic
902026386 1:13387175-13387197 AAGAACTTTGAAATGTGGCAGGG - Intergenic
902706823 1:18211174-18211196 CAGCCGTTAGAAATGGTCCAGGG - Intronic
903706158 1:25287402-25287424 AAGCAGTCAGGGGTGGGGCAGGG - Intronic
904014405 1:27408882-27408904 AAGGAGTTAGAAAGAGGGCAGGG + Intronic
904973692 1:34439201-34439223 AAAGAATTAGACATGGGGCAAGG - Intergenic
906875176 1:49529778-49529800 AGGCAGTTACAAATGGGGTATGG + Intronic
906919635 1:50049216-50049238 AAGCATTTAGGTAAGGGGCATGG - Intronic
907174736 1:52508440-52508462 AAGCAGATAGAACAGGGACAAGG - Intronic
909202991 1:72715632-72715654 ACACAGTTAGAAATGATGCAGGG - Intergenic
909272673 1:73643970-73643992 AAGCAGTTAGAACTGGGCCTGGG + Intergenic
909554702 1:76940685-76940707 AAGTAGTTAGAAGAGAGGCAGGG - Intronic
909664558 1:78118803-78118825 AGGCAGTAAGAAATGGGGCTGGG - Intronic
909788742 1:79646051-79646073 AAGTAGTTAGAAAAGTGGCAGGG - Intergenic
909987996 1:82186152-82186174 AAGCAGATTGAAATGGGGGTAGG - Intergenic
910895587 1:92066221-92066243 AAGCAGTTGGATGTGGGGAAGGG + Intergenic
911206641 1:95098281-95098303 AAAGGTTTAGAAATGGGGCAGGG - Intergenic
912080357 1:105928863-105928885 ATGCAGTTATAAAAGGGGCATGG + Intergenic
912974876 1:114320144-114320166 AAGCAGATAGAAATGGAGAAAGG + Intergenic
916060482 1:161095113-161095135 AAAGAGTCAGAAATGGGGCCAGG + Intergenic
916314749 1:163436793-163436815 AGGGAGTTAGCAATGGGGCAAGG - Intergenic
916717886 1:167460548-167460570 GAGTAGTTAGTAGTGGGGCATGG - Intronic
916807114 1:168269834-168269856 AGGCAGTTAGCACAGGGGCAAGG - Intergenic
916843700 1:168626777-168626799 CAGAAGTTTGAAATGGGGCTCGG + Intergenic
917421561 1:174869045-174869067 TAACCTTTAGAAATGGGGCAGGG - Intronic
918186264 1:182130160-182130182 AAGCAGTCAGCAAACGGGCAAGG + Intergenic
918394515 1:184100053-184100075 AAGCAATTACAAATGAAGCAGGG - Intergenic
918420203 1:184356604-184356626 AAGCAGTGAGAAAGGGAGGATGG + Intergenic
920567339 1:206985376-206985398 AAGCAGTTGGGAATAGGGCGTGG - Intergenic
921183685 1:212652156-212652178 AAGCAGGAAGAAAGGGGCCAGGG - Intergenic
921335898 1:214085917-214085939 AAGCAGTTAGATGTGGGGAGAGG - Intergenic
921904276 1:220479813-220479835 TAGTTGTTACAAATGGGGCAAGG - Intergenic
921997394 1:221436078-221436100 AAGCACTTAGACACGAGGCAGGG - Intergenic
922931448 1:229393099-229393121 AAGCAGACAGAAATGTTGCAAGG - Intergenic
923711258 1:236389141-236389163 AAGCAGCTGGAAATGGTGCTGGG + Intronic
1064161748 10:12952591-12952613 ATGAAGTTCAAAATGGGGCAAGG - Intronic
1064286761 10:13998314-13998336 GAGCAGTTTGAAATGGGCCATGG - Intronic
1064538007 10:16378119-16378141 AAGCAGCAAGAAATGTGGCCGGG + Intergenic
1065056364 10:21847055-21847077 AAACAGCTAGAAAAGGGGAAGGG - Intronic
1065057886 10:21865741-21865763 AAGCTGTTAAAAAGGGGACATGG + Intronic
1066489731 10:35883086-35883108 AAGAAGGGAGAAATGGGGCTGGG - Intergenic
1066546010 10:36501485-36501507 AAGCAGATATATAAGGGGCAAGG - Intergenic
1067770269 10:49117410-49117432 GAGCAGCTAGAGATGTGGCAGGG + Intergenic
1068101914 10:52565809-52565831 TAGTAGTTTGAAATGGGTCATGG + Intergenic
1069310496 10:67029415-67029437 AAGCAGTTGGCATTTGGGCATGG + Intronic
1070717336 10:78732314-78732336 AAGGAGTTAGTCTTGGGGCAAGG + Intergenic
1071038474 10:81277306-81277328 AAGCTGTCACAACTGGGGCATGG - Intergenic
1072505051 10:96057511-96057533 ATGATGTTAGGAATGGGGCAAGG - Intronic
1074574775 10:114658217-114658239 AAGCAATGAGAAATGGGGAGTGG + Exonic
1074625620 10:115181239-115181261 ATGCAGTTAAAAATGGGAGAAGG + Intronic
1075306736 10:121374693-121374715 AGGCAGTAAGGTATGGGGCAAGG - Intergenic
1075386581 10:122059688-122059710 AAGGAGTTAGACATTGAGCAAGG + Intronic
1075817709 10:125278387-125278409 AAGCAGAAAGAATGGGGGCAGGG - Intergenic
1076591985 10:131589751-131589773 AAGCAGTTAGCAGAGGGGCCGGG - Intergenic
1077563676 11:3282503-3282525 AAGCAGTGAGAGATGGAGCTGGG - Intergenic
1077569566 11:3328320-3328342 AAGCAGTGAGAGATGGAGCTGGG - Intergenic
1078748857 11:14141028-14141050 AGCCAGTGAGAAGTGGGGCATGG - Intronic
1079785490 11:24666129-24666151 GAGGAGCTAGAAATGGGGGAAGG + Intronic
1080086680 11:28291478-28291500 AAGCAGTTTGTGGTGGGGCATGG - Intronic
1080658892 11:34280059-34280081 AAGCATTTAGAGACTGGGCACGG - Intronic
1081553161 11:44132748-44132770 AGGGAGTTAGAAAGGGGGCCGGG - Intronic
1081602749 11:44506547-44506569 AAGCAGTGTGAACTGGAGCATGG + Intergenic
1083058870 11:59848869-59848891 CAAGAGTTAGACATGGGGCAGGG - Intergenic
1083597862 11:63927790-63927812 GAGCAGTTAGGAAGGGGGCTGGG - Intergenic
1085016741 11:73178830-73178852 AAGGAGGTAGGTATGGGGCAAGG - Intergenic
1086160768 11:83719562-83719584 AAACAGTGAGAAAAGAGGCAAGG + Intronic
1086773349 11:90797080-90797102 AAGCAGTTAACAGTGGGGTAGGG - Intergenic
1090540377 11:127696286-127696308 AAGCAGTTATCACTTGGGCATGG - Intergenic
1091393763 12:141370-141392 AAGCTGTTAGAACTGGAGCGAGG - Intronic
1092364484 12:7865623-7865645 AAGGAGAGAGAAATGGGGAATGG - Intronic
1092395603 12:8122680-8122702 AAGGAGTTAGGAATGTGGGAAGG + Intergenic
1092979245 12:13777213-13777235 AAAGAGTTAAAAATGGGGCCAGG + Intronic
1093203970 12:16224463-16224485 AATCAGGTAGAAACAGGGCATGG + Exonic
1094659268 12:32450813-32450835 AAGAAGTTACAAATGGGGCAAGG - Intronic
1096436096 12:51591794-51591816 ATGCAGTAAGACATGGGGGAGGG - Intronic
1096968510 12:55647461-55647483 TAGCAGATAGAAATCGGCCAAGG - Intergenic
1097529730 12:60783040-60783062 TTGCAATTAGAAATGGGGCTTGG + Intergenic
1098223089 12:68291136-68291158 CAGTAGTTAGAAATTGGCCATGG - Intronic
1100961806 12:99970631-99970653 AAGTAGTTTGATATGGAGCATGG - Intronic
1103085874 12:118061372-118061394 AACCAGATAAAAATGGGGCAGGG + Intronic
1103342740 12:120229811-120229833 AAGCAGGTAAATGTGGGGCATGG + Intronic
1103463951 12:121127236-121127258 AAGGAGTTAGATATGGGGCGGGG - Intergenic
1104231244 12:126886454-126886476 AAGCAGTAGGACATGGGGCAGGG + Intergenic
1104534108 12:129602376-129602398 AAGCAGATAGAAATGTTGCCTGG + Intronic
1106591794 13:31104647-31104669 ATGCAGATGGAAATGGGACAAGG - Intergenic
1109530887 13:63645088-63645110 AAGCAGATAGAAGTGGGGTTAGG - Intergenic
1111921473 13:94416183-94416205 AAGCAGTAAGAAATGGTGACGGG + Intergenic
1111950823 13:94707732-94707754 AAGCAGTAAGAACTGGTGCTGGG - Intergenic
1112900429 13:104351505-104351527 CAGCAAGTAGAAATGGGGCCAGG - Intergenic
1113049431 13:106193009-106193031 CAGGAGTTAGAAATGGAGAAAGG + Intergenic
1113477474 13:110594810-110594832 GAGCAGTTAAACATGGGGCTGGG - Intergenic
1113887867 13:113670527-113670549 AAGCAGGTGAGAATGGGGCATGG - Intronic
1114272468 14:21110137-21110159 AAGCATTTTAAAATGGTGCATGG + Intergenic
1115258045 14:31423331-31423353 AAGTAGTTATAAATGTGGAAGGG - Intronic
1115512262 14:34149321-34149343 AAGGAGTTAGAAATATGGAAAGG + Intronic
1115731944 14:36279496-36279518 AAACAGTTAAAAGTGGTGCATGG - Intergenic
1116391799 14:44400768-44400790 AAGGAACTAGAAGTGGGGCAGGG - Intergenic
1117999574 14:61510613-61510635 AAGCAGTTAGAGATGCGGCCTGG + Intronic
1118089083 14:62452130-62452152 AAGAAGTTAGAAGTTCGGCAGGG - Intergenic
1118736196 14:68703377-68703399 AGGCAGGTAAACATGGGGCAGGG - Intronic
1118867231 14:69713006-69713028 AAGCAGTGACAAAAGGGGGAGGG + Exonic
1118979062 14:70701573-70701595 AAGCAGATGCCAATGGGGCAGGG + Intergenic
1119136311 14:72224121-72224143 AAGCCATAAGAAATGGGGCTTGG + Intronic
1119903459 14:78281456-78281478 AAGCAGTCTGAGATGGGGCCTGG + Intronic
1121486335 14:94318979-94319001 ACCCAGTTAGAAATGGGCAAAGG + Intronic
1124033796 15:26034810-26034832 GAGGAGTTAGGAATGGGGCAGGG - Intergenic
1124178624 15:27451832-27451854 AAGCAATTAAAAATGGGCCAAGG + Intronic
1127303207 15:57677911-57677933 AAGCATTTAGAGACTGGGCATGG + Intronic
1127419441 15:58790810-58790832 AAGCAGGAAAAAATGGAGCAAGG + Intronic
1127646251 15:60962311-60962333 TAGCAGTTAGAAAGTGGGGAGGG - Intronic
1128945802 15:71819808-71819830 AAGCCCTTAGAAGTGGGGGAGGG - Intergenic
1129520483 15:76183020-76183042 ATGCAGGTTGCAATGGGGCAGGG + Intronic
1129775973 15:78236753-78236775 AAGCAGTTAAAACTGAGGCCAGG - Intronic
1130544140 15:84842427-84842449 AAGCAGTTATAGATCGGGAATGG + Intronic
1131123504 15:89838332-89838354 AAGCAGTAAGAAATGAGGTGAGG - Intronic
1131403245 15:92143273-92143295 AAGTAGTTTGAACTAGGGCAGGG + Intronic
1132101536 15:99026766-99026788 CAGCAGTTAGGAGAGGGGCATGG - Intergenic
1132844858 16:1995765-1995787 TAGCAGTGAGAAGTGGGGAAGGG - Intergenic
1133804460 16:9114206-9114228 AGGCAGTTAGAAATCTGGGAGGG + Intronic
1134911421 16:18030146-18030168 AATCACTTAGAAAGGAGGCAGGG - Intergenic
1135102984 16:19623118-19623140 CAGCAGCTAGAAATGGATCATGG + Intronic
1138095532 16:54208462-54208484 AAGGCGTTAGATATGGGGCGGGG - Intergenic
1138322516 16:56128385-56128407 AAGAAGTTACAAATGAGGAAAGG + Intergenic
1138413672 16:56858953-56858975 AGGCAGAAAGAAATGGGGCCAGG - Intergenic
1138967335 16:62100417-62100439 AAGAAGGTATATATGGGGCAGGG + Intergenic
1139101741 16:63775714-63775736 ATGCAGTGTGAATTGGGGCAAGG - Intergenic
1139297374 16:65913811-65913833 ACCCAGTTAAAAATGGGGAAAGG - Intergenic
1140791986 16:78400652-78400674 AAGCAGGTAGAAAGGGAACAGGG + Intronic
1144000189 17:11046874-11046896 ACCCAGTTAGAAAATGGGCAAGG + Intergenic
1144022746 17:11251625-11251647 TAGATGTTAGACATGGGGCAGGG - Intronic
1145923091 17:28626056-28626078 AAGCATTGAGAACTGGGGCCAGG - Intronic
1147323768 17:39660721-39660743 TAGCAGTTAGTAAAGGGGCCTGG + Intronic
1148522522 17:48293907-48293929 AAGAAGTTAGAAGTGCGGGAAGG + Intronic
1148560511 17:48603258-48603280 AAGGACTTAAAAATGGGGTAAGG - Intronic
1150031603 17:61742607-61742629 AAGGAGAGAGAAATGGGGGAAGG + Intronic
1151404511 17:73877942-73877964 AGGCATTTGGAAATGGGGCAGGG - Intergenic
1151507086 17:74536041-74536063 AATCATTTAGAAATGGGTCAAGG + Intergenic
1152458082 17:80427438-80427460 AAGCATCTAGAAATAGAGCAAGG + Intronic
1161921316 19:7268288-7268310 CCGCGGTCAGAAATGGGGCAAGG + Intronic
1162405079 19:10468492-10468514 AAGCAGCTAGAAGTGGGGCGGGG - Exonic
1163260894 19:16189311-16189333 AAGCACTGAGAGGTGGGGCATGG - Intronic
1165172263 19:33902275-33902297 AAGTAGTTTTAGATGGGGCAAGG - Intergenic
925346226 2:3173869-3173891 AGGCAGCTGGACATGGGGCAGGG - Intergenic
925899505 2:8498462-8498484 AAGAAGGGAGAACTGGGGCAGGG + Intergenic
925991889 2:9260864-9260886 AAGCAGATAGAGTAGGGGCAGGG - Intronic
925998917 2:9314636-9314658 AAACATTTAGAAAAGGGGCTGGG + Intronic
926363493 2:12112113-12112135 AAAAAGTTGGAGATGGGGCAAGG + Intergenic
928872431 2:35996361-35996383 TAGGATTTAGAAATGGTGCAAGG - Intergenic
929207970 2:39319891-39319913 AAACATTTAGATATGGGGGATGG + Intronic
932499880 2:72174044-72174066 CAGCTGTGAGAAAAGGGGCAAGG + Intergenic
933442620 2:82333237-82333259 AAGCAGTTCAAAATGAGGAAGGG + Intergenic
936706062 2:115075045-115075067 AAGCAGTTATACGTGGGTCATGG + Intronic
936925908 2:117736707-117736729 AAGCAGTTAGAACGGGGGCATGG + Intergenic
938691280 2:133791789-133791811 AAGCAAGGAGAACTGGGGCATGG + Intergenic
939759402 2:146155486-146155508 AAGCAGTGAGAATGGGGGGAGGG + Intergenic
939764896 2:146235449-146235471 ATGCAGTTCCAATTGGGGCAAGG + Intergenic
940879726 2:158934843-158934865 GAGCATTTAGAAATGGGACTGGG - Intergenic
941926093 2:170896531-170896553 AAGCAGTTAGAATGGGGCCTGGG + Intergenic
942677321 2:178441456-178441478 AAGCAGCTAAAAATGGGGTAGGG + Intronic
944694342 2:202187600-202187622 TAGGAATTAGAAATGGGGCCAGG - Intronic
945237837 2:207648904-207648926 AAACACTTAAAAATGGGACAAGG + Intergenic
948509768 2:238455989-238456011 AGGCAGTGACAAATGGGGGAGGG + Intergenic
948958776 2:241315829-241315851 AAGCAGTTGGCAAAGGGGCGGGG + Intronic
1171059877 20:21945787-21945809 CAGTAGCTAGAAATGGGCCATGG - Intergenic
1173884308 20:46443953-46443975 AAGGAGTTAGATGTGGGGCAGGG - Intergenic
1174708668 20:52682844-52682866 AAGCAGTTGCAGGTGGGGCATGG + Intergenic
1175793898 20:61759307-61759329 AAACAGTGAGAAAGGGGTCATGG + Intronic
1177131362 21:17260157-17260179 AGGCAGTTAGAAAGGTGGGAAGG + Intergenic
1178184963 21:30208637-30208659 AGGCAGTTAGGAAAGGGGCAGGG + Intergenic
1179230520 21:39500003-39500025 AAGCAGTCAGAAAGAGGGCAAGG + Intronic
1179494783 21:41764605-41764627 AAGCACTGAGAAATGTGGCAGGG + Intronic
1181386360 22:22548657-22548679 AAGCAGTTAGTGCTGGGGAATGG + Intronic
1182142409 22:27972482-27972504 AGCAAGTTAGAAATGGGGTAGGG - Intergenic
1182947110 22:34334038-34334060 AGGCAGTTAGCACAGGGGCAAGG - Intergenic
1183949340 22:41343944-41343966 AAGCATTTAGGACTGGCGCATGG + Intronic
1184395713 22:44237422-44237444 AAGCAGTCAGAAAAGGGGTGGGG - Intergenic
1185003014 22:48257559-48257581 AATCAGAGAGAAATGGGGAATGG - Intergenic
949732450 3:7129617-7129639 AAGCAGTAAGAAAGGGGATATGG - Intronic
951219831 3:20057296-20057318 AAGCAGTTAGAAATGAGGGCTGG + Intronic
952154225 3:30625881-30625903 TAGTAGTTAGAGATGGGGCATGG - Intronic
952438645 3:33299585-33299607 CTTCAGTTAGAAATGGGGTAAGG + Intronic
952920300 3:38279315-38279337 AACCAGATAGAAGTGGGGAAAGG + Intergenic
955949299 3:64226052-64226074 ATGCAGTTGGAATTGGGGTAAGG - Intronic
956581518 3:70819225-70819247 ATGCACTTAGAAAAGGGGCTTGG - Intergenic
958140981 3:89561766-89561788 AAGCAGTTAGAATTGGACCCTGG - Intergenic
958937065 3:100267184-100267206 AAACAGTTTGAAAAGGGGCAGGG + Intronic
960272421 3:115689577-115689599 AAATATTTAGAAATGGGTCATGG - Intronic
961041992 3:123684036-123684058 AAGCAGAAAGCCATGGGGCAGGG + Intronic
961735239 3:128997289-128997311 AAGCTGTTAAAAATGGGGAAGGG - Intronic
962007482 3:131362459-131362481 AAGGAATAAGATATGGGGCAGGG - Intergenic
962835170 3:139183454-139183476 ACACAGTTAGAAATGGAGCTTGG + Intronic
962903184 3:139778676-139778698 AAGGTGTGAGAAATGGGTCAGGG - Intergenic
963800212 3:149668701-149668723 AAGTAGTTACCAATGGGGAACGG + Intronic
965687088 3:171315663-171315685 AAGAAGTTAGGAAGGAGGCATGG - Intronic
965916546 3:173855028-173855050 TAACAGTTAAAAATGTGGCATGG - Intronic
966621203 3:181966121-181966143 AAACAGTAAGAGGTGGGGCAGGG + Intergenic
966625489 3:182011531-182011553 AAGCAGAGAGAAATGGAGCTTGG + Intergenic
970739980 4:19224650-19224672 AAACAGTTATAAATGGGCAAAGG - Intergenic
970795892 4:19912994-19913016 AACCAGACAGAGATGGGGCAGGG + Intergenic
971394594 4:26216493-26216515 ACCAAGCTAGAAATGGGGCAAGG + Intronic
971545754 4:27883472-27883494 AATGAGTTATAAATGGGGCCTGG + Intergenic
972066943 4:34958931-34958953 AATTAGTGAGAAATGGGGGAAGG - Intergenic
972843829 4:42963558-42963580 AATCAATAAGAAATGGGGCCTGG + Intronic
974019517 4:56680320-56680342 AAGCAGATAGGAATAGAGCAGGG - Intronic
975475722 4:74821209-74821231 AAGGAGTTAGATGTGGGGCAAGG + Intergenic
977503557 4:97873239-97873261 AAGGAGTTATAAATGTGGAAAGG - Intronic
977709401 4:100107283-100107305 AAACAATTAGAAATGTGGCAAGG + Intergenic
979342780 4:119547059-119547081 AAGCAATTAGAAGGGAGGCAAGG - Intronic
980230237 4:130038704-130038726 AAGCAGTAAGAAATCGAGCTCGG + Intergenic
989242729 5:39219222-39219244 AAGCAGATAAAAATGTGGCCGGG - Intronic
989565650 5:42898623-42898645 AAGCTGACAGAAAGGGGGCAGGG - Intergenic
989566833 5:42909429-42909451 AAGCAGACAGAAAGGGGGCAGGG - Intergenic
989567563 5:42916260-42916282 AAGCAGACAGAAAGGGGACAGGG + Intergenic
989573953 5:42971821-42971843 AAGCAGACAGAAAAGGGGCAGGG + Intergenic
990026051 5:51191054-51191076 CAGCAGTTAGAAAGGAGGGAGGG - Intergenic
990159604 5:52923112-52923134 AAGGAGTTAGATGTGGGGCAGGG + Intronic
992253212 5:74896249-74896271 AAGCAGTAATGGATGGGGCAGGG + Intergenic
992483233 5:77171736-77171758 AGGCAGGTGGTAATGGGGCAGGG + Intergenic
993810595 5:92470964-92470986 GGGCAGGTAGAAGTGGGGCAGGG + Intergenic
994898709 5:105742200-105742222 AACCAGTTAAAACTGGAGCAAGG - Intergenic
995061822 5:107819517-107819539 GATCAGTTGGAAATGGGGCAGGG + Intergenic
998791354 5:145768869-145768891 GAACAGTTAGAAATGGAACATGG + Intronic
999317529 5:150593997-150594019 ATGAAGTCAGACATGGGGCAGGG + Intergenic
1000608841 5:163353791-163353813 AGGAAGTCAGAAATGGGGGAAGG - Intergenic
1000684982 5:164237579-164237601 AATCAGTTAGAAATATGTCAAGG + Intergenic
1002040972 5:176514010-176514032 AAGCAGTTCCAAGTGAGGCATGG - Intergenic
1002763713 6:221243-221265 ATGAAGTTAGAAATGGCACACGG - Intergenic
1004085687 6:12446745-12446767 ATGCAGTCAGAAAAGGGGCTGGG - Intergenic
1004166622 6:13262377-13262399 CAGCAGTTAGAAAGGTGGCCAGG + Intronic
1005458016 6:26040306-26040328 AAGAATTTAGAAATGTGGCCGGG + Intergenic
1006938627 6:37736460-37736482 AGCCAGTTGCAAATGGGGCAGGG - Intergenic
1007636988 6:43305618-43305640 AACCAGATAGAAATGGGAAAGGG + Exonic
1007760428 6:44130088-44130110 AAGCAGGTAGAAATAGGGTATGG + Intronic
1007934763 6:45723083-45723105 AACCAGTTAGAGAGGGAGCAGGG + Intergenic
1007989897 6:46244253-46244275 AAGCAGTTGGCGATGGGGGATGG - Intronic
1008159413 6:48059343-48059365 AAGAAGTTAAAAAATGGGCAGGG + Intronic
1010134326 6:72532602-72532624 AAGAGGTGAGAAATGGGGCTGGG + Intergenic
1012804977 6:103882405-103882427 AAGCAGTTGGTAATAGAGCAAGG - Intergenic
1013482792 6:110566568-110566590 TAGCTGTGAGACATGGGGCAAGG - Intergenic
1014389942 6:120849361-120849383 AAACAATTATAAATGAGGCAGGG - Intergenic
1014505819 6:122253765-122253787 ACTCAGTTAAAAATGGGGAAAGG - Intergenic
1015455498 6:133422957-133422979 AAGCAGTCAGAGAGTGGGCAAGG - Intronic
1015970624 6:138739704-138739726 AAGCAGTAAGAAATGCACCAAGG + Intergenic
1016833570 6:148455711-148455733 AATGAATTAGAAGTGGGGCAGGG + Intronic
1020725360 7:11806722-11806744 AAGCAGGTAGAAAAGGTTCATGG + Intronic
1021811262 7:24403744-24403766 AAACAGGTAGAAATCGTGCATGG - Intergenic
1022336152 7:29423862-29423884 ATGCAGCTACAAATGGGGCATGG - Intronic
1023538628 7:41240683-41240705 AAGCAGTGAGAAAAGGGGCAAGG - Intergenic
1023546189 7:41319845-41319867 AAGGAGTTACAAATGAGACAGGG - Intergenic
1023997097 7:45166482-45166504 AAGCAATTAAAAATGGGCAAAGG - Intronic
1024751543 7:52471555-52471577 AATCAGTTAGAAATGAGACAGGG + Intergenic
1025155651 7:56603758-56603780 ATGCAGTTAGAAAGGGAGTATGG - Intergenic
1027664611 7:81029650-81029672 AAGCAGCTGGAAATGGAGAAAGG - Intergenic
1027929153 7:84508698-84508720 AATCAGTTAGACAAGGGGCTAGG + Intergenic
1028809054 7:95062759-95062781 AAGCAGAAAAAAGTGGGGCAGGG - Intronic
1030375613 7:108750009-108750031 AAGCAGCTGGAAATGTGGAAAGG - Intergenic
1030490331 7:110224804-110224826 AAGCAGACAGAGATGTGGCATGG + Intergenic
1031266040 7:119581777-119581799 AAAAAGTTAGAAAAGGGGCCGGG - Intergenic
1031536965 7:122946669-122946691 AAGCACTTATAACTGGGCCAAGG - Intergenic
1032947489 7:136870012-136870034 AAGCAATTAGAATGGGGGAAAGG + Intronic
1033470516 7:141643577-141643599 AAGCAATGAGAAATGGGCAAAGG + Intronic
1033574235 7:142664757-142664779 ATGAAGTCAGAGATGGGGCAGGG - Intergenic
1033726462 7:144123711-144123733 AGGCAGTTAGCAGAGGGGCAAGG - Intergenic
1034225863 7:149480916-149480938 AAAAGGTTAGAAAGGGGGCAAGG + Intronic
1035954472 8:4060794-4060816 AAAAAGGTAGGAATGGGGCAAGG + Intronic
1036224025 8:6943260-6943282 GAGGAGTCAGACATGGGGCATGG + Intergenic
1037115427 8:15220450-15220472 AAGCAGTTAGAAATGGGGCAAGG - Intronic
1037952511 8:23028225-23028247 AGGCACTTAGACTTGGGGCAGGG + Intronic
1037961702 8:23102818-23102840 AAGCACTCAGAAAAGGGGCATGG - Exonic
1038051406 8:23816653-23816675 AAGGGTTTAGAAATGGGGGAAGG + Intergenic
1038187590 8:25289545-25289567 AAGAAGAAAGAAATGGGGCTGGG + Intronic
1038982765 8:32777474-32777496 CAGCAGGTAGACATGAGGCATGG - Intergenic
1039668808 8:39571203-39571225 AACCCGTTAAAAATGGGCCAAGG + Intergenic
1041111715 8:54489085-54489107 AAACACTGGGAAATGGGGCAGGG + Intergenic
1042524512 8:69750232-69750254 AGGCAGGTAGAAAGGGGGCAAGG + Intronic
1043151580 8:76723892-76723914 AAGCAGTTAGAAAGGTAGCCAGG + Intronic
1046691402 8:117289582-117289604 AAGAAGTTAGAAATATGGAAAGG - Intergenic
1046796773 8:118381909-118381931 CAGCAGCCAGAAATGGGGAAAGG - Intronic
1047350598 8:124069744-124069766 AAGCACCTAGAGATGGGCCAAGG - Intronic
1052978882 9:34432687-34432709 ACGCAGTTGGAAATGGGGTCTGG - Intronic
1054805027 9:69389376-69389398 CAGCAGGTAGAAAGGGGGAACGG - Intronic
1056780375 9:89544586-89544608 AGGCAGGTAGGAAGGGGGCAGGG - Intergenic
1058040358 9:100295518-100295540 AAGCAGTGAGGGCTGGGGCAGGG + Intronic
1058087764 9:100767567-100767589 AAACAATTAGAAATGGTGAAGGG - Intergenic
1058985775 9:110207529-110207551 AAGCTGCCAGAAGTGGGGCAGGG + Exonic
1059918069 9:119126015-119126037 TAGCTGTGAGAAATGGGGCTGGG - Intergenic
1060788750 9:126471097-126471119 AACTAGTTAGAAGTGGGGCCTGG + Intronic
1186064326 X:5745263-5745285 AAACATTTAGAAAAGGGGGAGGG + Intergenic
1186364199 X:8874386-8874408 CAGCAGTCAGAATTGGGGCCAGG + Intergenic
1189095908 X:38139244-38139266 AACCAGTAATAAATGGTGCAGGG + Intronic
1191881072 X:65844181-65844203 AAGAAGATAGAAATGGAACAGGG + Intergenic
1191912020 X:66161408-66161430 AAGGAGATAGAAATGGGCAAGGG - Intergenic
1195956318 X:110334835-110334857 AAGCAGGCAGAAATGTGCCAAGG - Intronic
1196747581 X:119085562-119085584 AAGGAGTTAGAACTGAAGCAAGG + Intronic
1197728773 X:129793521-129793543 AAGCAGTGAGGAGAGGGGCAGGG + Intronic
1198177432 X:134171005-134171027 AAGCACTTGGAAATGGGAGAAGG - Intergenic
1198393471 X:136200199-136200221 ATACAGTTAGAAATGTGGCTGGG - Intronic
1198409943 X:136356567-136356589 AAGAACTGAGAATTGGGGCAAGG - Intronic
1198513487 X:137378638-137378660 AAGAAGTGTGAAATTGGGCAGGG + Intergenic
1198778538 X:140208080-140208102 AAGAAGTTAAGAATGGGGCCTGG - Intergenic
1199115066 X:143982197-143982219 AAGCAATAACAAATGCGGCAAGG - Intergenic
1199473975 X:148225971-148225993 AAGCAGTTGAAAATGGGGAAAGG - Intergenic
1199608746 X:149596299-149596321 AAGCAGTAACAAGTGTGGCAAGG + Intergenic
1199630376 X:149773061-149773083 AAGCAGTAACAAGTGTGGCAAGG - Intergenic