ID: 1037121811

View in Genome Browser
Species Human (GRCh38)
Location 8:15297931-15297953
Sequence TGCACTCATGTCTGCAGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037121809_1037121811 27 Left 1037121809 8:15297881-15297903 CCAAAAACTGGAGCTTTATTTCT No data
Right 1037121811 8:15297931-15297953 TGCACTCATGTCTGCAGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037121811 Original CRISPR TGCACTCATGTCTGCAGCCA AGG Intergenic
No off target data available for this crispr