ID: 1037123421

View in Genome Browser
Species Human (GRCh38)
Location 8:15317001-15317023
Sequence CGGCAAAGAGCAGTGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037123415_1037123421 22 Left 1037123415 8:15316956-15316978 CCTGCGGATCTGGAGGAATGGAA No data
Right 1037123421 8:15317001-15317023 CGGCAAAGAGCAGTGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037123421 Original CRISPR CGGCAAAGAGCAGTGGTGGA TGG Intergenic
No off target data available for this crispr