ID: 1037129329

View in Genome Browser
Species Human (GRCh38)
Location 8:15388854-15388876
Sequence GACTCTTATTTTCAGGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037129329_1037129333 -7 Left 1037129329 8:15388854-15388876 CCCACCACCTGAAAATAAGAGTC No data
Right 1037129333 8:15388870-15388892 AAGAGTCTTGTGATCATTTATGG No data
1037129329_1037129336 29 Left 1037129329 8:15388854-15388876 CCCACCACCTGAAAATAAGAGTC No data
Right 1037129336 8:15388906-15388928 CTGTTCCACCTCAGATCATCAGG 0: 715
1: 1055
2: 826
3: 438
4: 330
1037129329_1037129335 0 Left 1037129329 8:15388854-15388876 CCCACCACCTGAAAATAAGAGTC No data
Right 1037129335 8:15388877-15388899 TTGTGATCATTTATGGTTTTGGG No data
1037129329_1037129334 -1 Left 1037129329 8:15388854-15388876 CCCACCACCTGAAAATAAGAGTC No data
Right 1037129334 8:15388876-15388898 CTTGTGATCATTTATGGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037129329 Original CRISPR GACTCTTATTTTCAGGTGGT GGG (reversed) Intergenic
No off target data available for this crispr