ID: 1037147638

View in Genome Browser
Species Human (GRCh38)
Location 8:15592529-15592551
Sequence GAGAGTTAGGAGGAGGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 822
Summary {0: 1, 1: 0, 2: 8, 3: 99, 4: 714}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037147638_1037147643 8 Left 1037147638 8:15592529-15592551 CCTGCCACCTCCTCCTAACTCTC 0: 1
1: 0
2: 8
3: 99
4: 714
Right 1037147643 8:15592560-15592582 GCTCTCACCATGTGATACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037147638 Original CRISPR GAGAGTTAGGAGGAGGTGGC AGG (reversed) Intronic
900149080 1:1170494-1170516 GAGAGGAAGGAGGAGGGGGAGGG - Intergenic
900244702 1:1631659-1631681 GAGAGCTGGGAGGGGATGGCCGG - Intergenic
900312330 1:2039902-2039924 GAGAGTTGGAAGGAGGAGGCAGG + Intergenic
900849424 1:5130622-5130644 GAGAGTCAGGAGGTGGTTGTTGG + Intergenic
901197891 1:7450437-7450459 CAGAGGTGGGTGGAGGTGGCAGG - Intronic
901644011 1:10706958-10706980 GAGAGGATGGAGGAGGAGGCCGG + Intronic
901711426 1:11118736-11118758 GCTACTTAGGAGGATGTGGCGGG - Intronic
901860293 1:12070025-12070047 GGTGGTTAGGAGAAGGTGGCAGG + Intronic
902161049 1:14530608-14530630 GAGAGAGAGGAGGAGGTGCCAGG - Intergenic
902688989 1:18097900-18097922 GAGAAAGAGGAGGAGGTGTCAGG - Intergenic
903136484 1:21312692-21312714 GAGAGGTAGGAGGATGCAGCAGG + Intronic
903231838 1:21927032-21927054 GGGAGTGGGGAGGTGGTGGCAGG + Intronic
903294045 1:22332446-22332468 GAGACTTGGGAGGAGAAGGCTGG - Intergenic
903680807 1:25095589-25095611 GAGAGTGGGGAGGTGGTGGGGGG - Intergenic
903776507 1:25797531-25797553 AAGAGGGAGGAGGAGGAGGCAGG - Intergenic
903818720 1:26084479-26084501 GAGATTTAGAAGGAGATGGGAGG + Intergenic
904267784 1:29327422-29327444 GAGAGGGAGGAGGAGCAGGCTGG + Intergenic
904708318 1:32408864-32408886 AATAGTTAGAAGGAGTTGGCTGG + Intergenic
904753112 1:32753671-32753693 GACAGTCACGGGGAGGTGGCTGG + Intronic
905258786 1:36703088-36703110 GAGAAAGAGGAGGAGGTGCCAGG + Intergenic
905349913 1:37338291-37338313 GAGAGGTATGCGGAGGTGGGTGG + Intergenic
905540109 1:38753919-38753941 GAGAGAGAGGAGGAGGTGCCAGG - Intergenic
905675959 1:39825257-39825279 GATAGTGAGGAGGGGGTGGTTGG + Intergenic
905940301 1:41857785-41857807 GAGAGGTAATAGGAGGTAGCAGG - Intronic
905948370 1:41923473-41923495 CAGAGGCTGGAGGAGGTGGCGGG + Intronic
906125066 1:43422675-43422697 GAGACATGGGATGAGGTGGCGGG - Intronic
906591172 1:47025212-47025234 GAGAGAGGGGAGGAGGTGGCAGG - Intronic
906680258 1:47721467-47721489 GTGAGGGAGGAGGAGGTGTCAGG - Intergenic
907517228 1:55000445-55000467 GTGAGTTAGGAGGGGGGGGTGGG + Intronic
907554822 1:55334713-55334735 GAGAGACAGCAGGAGTTGGCAGG + Intergenic
907595582 1:55716548-55716570 GGGAGGTAGGAGGAGGTCGATGG + Intergenic
908151717 1:61309592-61309614 GAAATTTAGGTGGATGTGGCCGG + Intronic
908388150 1:63662197-63662219 GGGAGGAAGAAGGAGGTGGCTGG + Intergenic
908754064 1:67451668-67451690 GAGAATTAGGAGGAAGTGTCAGG + Intergenic
909716779 1:78717876-78717898 GAGAGAGGGGAGGAGGTGCCAGG + Intergenic
909748427 1:79128274-79128296 TCGAGTTAGGAGGAGGGGGATGG - Intergenic
910138505 1:83999512-83999534 CGGAGGTAGAAGGAGGTGGCCGG - Intergenic
910299962 1:85694841-85694863 GAAACTTGGGAGGAGGTGGTAGG + Intronic
910576348 1:88768953-88768975 GAGAGAGAGGAGGAAGTGCCAGG + Intronic
910724375 1:90323244-90323266 GACAGAGAGGAGGAGGTGCCAGG + Intergenic
911420859 1:97638752-97638774 GAGAGAAAGGAGGAAGTGTCGGG + Intronic
912197752 1:107419222-107419244 GAGAGGAGGGAGGAGGTAGCGGG - Intronic
912954589 1:114145880-114145902 GAGAGGTAGGAGAAGGGGGTGGG + Intronic
913006821 1:114641548-114641570 GAGAGTTGAGAGGAGGTGCCAGG - Intronic
913070227 1:115292005-115292027 GAGATGGAGGAGGAGGAGGCTGG - Intronic
914035904 1:144002546-144002568 GGGAGTGAGCAGGAGGTGGTGGG + Intergenic
914153552 1:145065399-145065421 GGGAGTGAGCAGGAGGTGGTGGG - Intronic
914413426 1:147454882-147454904 GAGAGAGAGGAGGAGATGCCAGG + Intergenic
915294988 1:154913953-154913975 GAGAGACAGCAGGAGGTGCCAGG - Intergenic
915417441 1:155752829-155752851 AAGAGTTGGGTGGAGGTGGGGGG + Intronic
915479154 1:156173370-156173392 GAGAGGAAGGAGGTGGTGGCTGG + Intronic
915964497 1:160294520-160294542 GACAGGAAGAAGGAGGTGGCTGG - Exonic
916061904 1:161104866-161104888 GGGAGAAAGGAGGAGGTTGCTGG - Intronic
916260168 1:162833991-162834013 GAGGGTAAGCAGGAGGTGGCAGG + Intronic
916400896 1:164447706-164447728 GAGAGAGAGGAGGAGGTGCCAGG + Intergenic
917711441 1:177689129-177689151 CAGAGATAGAGGGAGGTGGCAGG - Intergenic
919746164 1:201010428-201010450 GAGAGAAAGGAAGGGGTGGCTGG - Intronic
920245938 1:204587700-204587722 GGGAGTCAGGAGGCCGTGGCTGG - Intergenic
920471369 1:206233423-206233445 GGGAGTGAGCAGGAGGTGGTGGG + Intronic
920511097 1:206552586-206552608 AAGAGTTTGGAATAGGTGGCGGG + Intronic
920540008 1:206771085-206771107 GAGAGATTGGCGGAGGTGGCTGG + Intronic
920861164 1:209708219-209708241 GTCAGTTAGAAGGATGTGGCTGG + Intronic
921076219 1:211702197-211702219 GTGAGTGAGGAGGAGGTGTCTGG + Intergenic
921135667 1:212257064-212257086 GATGGTTAAGAGGAGGGGGCTGG - Intergenic
921195256 1:212750307-212750329 GTGAGCTGGGAGGAGGTGGGTGG + Intronic
921231865 1:213081350-213081372 GAGAGAGAGGAGGAGGTGCCAGG + Intronic
921510478 1:216022016-216022038 GAGAGAGAGGAGGAAGTGTCAGG - Intronic
921946672 1:220890663-220890685 GAGAGTTAGGATGTGCTGCCTGG + Intergenic
921960388 1:221027801-221027823 GATAGAGAGGAGGAGGTGCCAGG - Intergenic
922090327 1:222389608-222389630 GAGGGTTAGGGGGAGGTGGGTGG - Intergenic
922506292 1:226127909-226127931 CAGACTTAGGAGGAGGTACCGGG - Intergenic
922812964 1:228428271-228428293 AAGAGAGAGGAGGAGGTGCCGGG + Intergenic
922970099 1:229728997-229729019 GAGGGGTACGAGGAGGTGCCAGG - Intergenic
923021845 1:230170768-230170790 GAGAGAGGGGAGGAGGTGCCAGG + Intronic
923417065 1:233773309-233773331 AAGAGGGAGGAGGAGGTGCCAGG + Intergenic
923842057 1:237683807-237683829 GAGAGTTGGGAGGCCATGGCAGG + Intronic
924561205 1:245156969-245156991 GAGAGCTGGGAGGGGGCGGCAGG - Intronic
924604151 1:245517766-245517788 AAGAATGAGCAGGAGGTGGCTGG + Intronic
1063178399 10:3572542-3572564 AAATGTTAGGAGGAGGTGGCTGG - Intergenic
1063243319 10:4193306-4193328 GAGGGTTATGAAGTGGTGGCAGG + Intergenic
1063541098 10:6934634-6934656 GAGAGGGAAGAGGAGGTGCCAGG - Intergenic
1064292987 10:14052533-14052555 GAGAGTGGGGAGGAGGTGCCAGG + Intronic
1064429459 10:15258305-15258327 GAGAGTTGGGAGGCTGAGGCAGG - Intronic
1064462802 10:15551259-15551281 GAGAGAGAAGAGGAGGGGGCTGG + Intronic
1064628645 10:17286661-17286683 AAGAGGGAGGAGGAGGTGTCAGG + Intergenic
1064864030 10:19859052-19859074 GGGAGAGAGGAGGAGGTGCCAGG + Intronic
1064978941 10:21147222-21147244 GAGAGGCAGGAGGAGGTCCCAGG - Intronic
1065664337 10:28041725-28041747 GACAGCAAGGAGGAGGTGGAAGG + Intergenic
1065833020 10:29631802-29631824 GAGGCTTAAGAGGAGGTGGTGGG + Intronic
1065883949 10:30060331-30060353 GAGAGATAGGAGGAGGTCAGTGG + Intronic
1066068360 10:31778792-31778814 GAGGGTGAGGAGGAGTTAGCTGG - Intergenic
1066229584 10:33419402-33419424 GAGAGTTAGGAGGAGGAAGCTGG + Intergenic
1066242976 10:33555783-33555805 GAAAGCAAGGAGGAGGTGCCAGG - Intergenic
1066703805 10:38156817-38156839 GAGGGTGAGGAGGAGGTCGGGGG + Intergenic
1067525575 10:47036347-47036369 GAGAGTGAGGGGCAGGTGTCAGG + Intergenic
1067710859 10:48650036-48650058 GAGAGAGACCAGGAGGTGGCAGG + Intronic
1068041042 10:51824734-51824756 GAGAGAGAGGAGGAGGTGCCAGG + Intronic
1069684755 10:70310497-70310519 GAGAGTTTGGAGGGGGATGCAGG - Intronic
1069870461 10:71529805-71529827 GTGGGTAAGGAGGAGGTGGGAGG - Intronic
1070257756 10:74825932-74825954 GAGAGGGTGGAGGAGGGGGCGGG + Intronic
1070327978 10:75400286-75400308 GAGAGTTTGGAGGAGGGCGAGGG + Exonic
1071008319 10:80909463-80909485 GGGAGTGAGGGGGAGGTGCCAGG + Intergenic
1071277438 10:84068614-84068636 GAGAGTGAGGAGGAGGTATCAGG - Intergenic
1071294178 10:84207250-84207272 GAGAGTGAGGAGGAGGAGAGGGG + Intronic
1071335993 10:84601001-84601023 CAGAATTTGGAGGAGCTGGCAGG - Intergenic
1071400885 10:85269549-85269571 GAGAGAGAGGAGGAGGTGGCAGG + Intergenic
1071572675 10:86706597-86706619 GAGAGGCAGCAGCAGGTGGCTGG - Intronic
1071746594 10:88426742-88426764 GACAGTAAGGAGGAGGAGCCAGG + Intronic
1072479572 10:95797659-95797681 GAGAGAAAGGAGGAGGTGCCAGG + Intronic
1072497162 10:95973131-95973153 GTGAGCAAGGAGGAGGGGGCGGG + Intronic
1072681604 10:97511574-97511596 GGGAGGTAGGAAGAGGTGGAAGG - Intronic
1073325787 10:102643543-102643565 GAAAGTGGGGAGGAGGGGGCCGG + Intergenic
1073340916 10:102743993-102744015 GAGAGGGAGGAGGAGGAGGGAGG + Exonic
1073426560 10:103458766-103458788 GTGAGTTGGGAAGAGGAGGCCGG - Exonic
1073502151 10:103949937-103949959 GAGAGAGAGGAGGAGGTGCCAGG + Intergenic
1073545018 10:104340372-104340394 GACAGTTTGGAGGAGGAGGTGGG - Intergenic
1073809472 10:107136894-107136916 TAGAGTTAGGTGGAGCTGACTGG - Intronic
1074604994 10:114953821-114953843 GAGAGAGAGGCGGAGGTGCCAGG + Intronic
1074610506 10:115016822-115016844 GAGAGTCTGGAGGGGGTGGTGGG + Intergenic
1074704060 10:116115845-116115867 GAGTGCTAGCAGGAGGTGGCTGG + Intronic
1075081475 10:119386816-119386838 CAGAGGAGGGAGGAGGTGGCGGG + Intronic
1075166422 10:120071951-120071973 GAGAGAGAGGAGGAGGTGCCAGG + Intergenic
1075620032 10:123919905-123919927 GAGAGAGAGGAGGAGGTTCCAGG + Intronic
1076532806 10:131155857-131155879 GTGAGGGAGGAGGAGTTGGCGGG - Intronic
1076930030 10:133525949-133525971 GAAAGAGAGGAGGAGGCGGCAGG + Intronic
1077054543 11:584549-584571 GAGGGGCAGGAGGAGGTGGCTGG + Intronic
1077065095 11:637537-637559 GAGAGCGAGGAGGAGGTCGGCGG - Exonic
1078050574 11:7961995-7962017 GAGAGAGGGGAGGAGGTGCCAGG - Intronic
1078181568 11:9015997-9016019 GAGAATGAGGAGGTGGTGGGAGG - Intergenic
1078723530 11:13906270-13906292 GAGAGAGGGGAGGAGGTGCCAGG + Intergenic
1079172080 11:18105977-18105999 GAGGAGGAGGAGGAGGTGGCCGG - Exonic
1079333417 11:19551691-19551713 GAGAGGAAGCAGGACGTGGCTGG - Intronic
1079405304 11:20140143-20140165 AAGAGGGAGGAGGAGGAGGCGGG - Intergenic
1081886907 11:46505762-46505784 GAGAGAGAGGAGGTGGTAGCAGG + Intronic
1081906622 11:46674415-46674437 GAGAGGTTGGAGGAGGAGGAGGG - Intronic
1082274358 11:50205824-50205846 GAGAGAGAGGAGGAGGTTCCAGG - Intergenic
1082862563 11:57869856-57869878 GAGAATGGGGAGGAGGTGCCAGG + Intergenic
1083473555 11:62900669-62900691 CAGATTTAAGAGGAGGAGGCTGG + Intergenic
1084890593 11:72235059-72235081 GAGGGGCAGGAGGAAGTGGCGGG + Intronic
1085243189 11:75075361-75075383 GAGGCCTTGGAGGAGGTGGCAGG + Intergenic
1085471728 11:76762898-76762920 GAGTGTTAGCAGGGGGTGGATGG - Intergenic
1085650054 11:78259720-78259742 GAGAGGTAGGAGGAGGGTGGTGG - Intronic
1087219514 11:95531245-95531267 AAGAGAGAGGAGGAGGTGCCAGG - Intergenic
1088640890 11:111871689-111871711 TAGAGTTAGAAGCAGGTGGATGG - Intergenic
1088814634 11:113412773-113412795 GAGAGTCAGCTGGTGGTGGCTGG + Exonic
1088923388 11:114278238-114278260 GAGAGAGAGGAGGAGATGCCAGG + Intronic
1089111798 11:116063133-116063155 TGGGGGTAGGAGGAGGTGGCCGG + Intergenic
1089179965 11:116576709-116576731 GAAAGAGAGGAGGAGGTGCCAGG + Intergenic
1089590681 11:119538619-119538641 GAGAGAGGGGAGGAGGTGCCAGG - Intergenic
1089642849 11:119859132-119859154 CAGGGTTAGGATGAGGGGGCAGG + Intergenic
1089705900 11:120277379-120277401 CAGGGTTAGAAGGAGGTGGAGGG - Intronic
1089833813 11:121352404-121352426 GTGGGTTAGGAGGGGGAGGCTGG + Intergenic
1090186564 11:124742955-124742977 GGGAGGGAGGAGGAGGTGGAAGG - Intronic
1091034355 11:132219809-132219831 GGGAGTGAAGAGGAGGGGGCTGG - Intronic
1091283665 11:134396395-134396417 GAGAGCAAAGAGGTGGTGGCAGG - Intronic
1091337122 11:134780619-134780641 AAGAGTGAGGAGGAGGAGGAGGG - Intergenic
1091380255 12:53407-53429 GAGGGTGAGGAAGAGTTGGCAGG + Intergenic
1091796273 12:3299076-3299098 GAGAGGAAGAAGAAGGTGGCGGG - Intergenic
1092012980 12:5131189-5131211 GAGAGGTAGGAAGCAGTGGCAGG - Intergenic
1092614392 12:10203187-10203209 GAGAGATAGGAAAAGGGGGCAGG - Intergenic
1092701271 12:11233704-11233726 AAGAGAGAGGAGGAGGTGCCAGG + Intergenic
1092913868 12:13172121-13172143 GAGGGGCAGGAGGAGCTGGCAGG + Intergenic
1093070708 12:14705221-14705243 GAGAGAGAGGATGAGGTGCCAGG + Intergenic
1093790470 12:23244232-23244254 AAGAGTTTGGAGGAGTTGGCTGG + Intergenic
1094041737 12:26126218-26126240 GAGAGTTACCGGGAGGTGCCCGG + Intronic
1094066703 12:26369239-26369261 GAAGGTTTGGAGCAGGTGGCAGG + Intronic
1094228923 12:28080655-28080677 GAGAGACAGGAGGAGGTGCAAGG - Intergenic
1094485474 12:30923239-30923261 GAGAGTGTGGAGGAGGTGCCAGG + Intergenic
1094703827 12:32896441-32896463 GCGGGATAGGAGGAGGTGACCGG + Intronic
1095175563 12:39088421-39088443 GAGATTTAGGAGGAAGAGGGTGG - Intergenic
1095728915 12:45483640-45483662 GAGAGAGAGAAGGAGGTGCCAGG + Intergenic
1096883926 12:54698380-54698402 GAGAGTCAGGAATAGGTGGCAGG - Intergenic
1097288342 12:57894555-57894577 GAGGGTTAGAAGGTGGAGGCTGG + Intergenic
1097357685 12:58620600-58620622 GAGAGAGGGGAGGAGGTGTCAGG - Intronic
1097874822 12:64633440-64633462 GAGAGAGAGGAGGAGGTGCCAGG - Intronic
1098270180 12:68762388-68762410 CAGAGGAAGGAGGAGGAGGCGGG + Intronic
1098275045 12:68804731-68804753 GAGGGTTAGGAGAAGGTTGGGGG - Intergenic
1099435827 12:82643895-82643917 GAGAGAGAAGAGGAGGTGCCAGG + Intergenic
1100718295 12:97328689-97328711 GAGAATTAGGAGGTGCGGGCAGG + Intergenic
1101337185 12:103807181-103807203 GAGAGTTGAGAGAAGTTGGCAGG - Intronic
1101688528 12:107050488-107050510 GAGAGAGGGGAGGAGGTGCCAGG - Intronic
1101992724 12:109500607-109500629 GAGAGTCAGGAGGCTGTGGGAGG + Intronic
1102591393 12:113959226-113959248 GAGAGTGAGGAGGAGGGAGCCGG - Exonic
1102700464 12:114834780-114834802 GAGAGCTGGCAGGAAGTGGCTGG + Intergenic
1102737415 12:115175048-115175070 CTGAGTTAGCAGGAGCTGGCAGG + Intergenic
1102753874 12:115320973-115320995 GGGAGTTTGGAGGAGGTGGTGGG + Intergenic
1103014018 12:117480243-117480265 ATGAGTCAGGAAGAGGTGGCAGG - Intronic
1103024276 12:117560821-117560843 GAGAGATAGAAGGAGATGCCAGG - Intronic
1103037959 12:117671790-117671812 GGGAGTTTGGGGGAGGTGGGTGG - Intronic
1103480106 12:121245248-121245270 GGGAGAAAAGAGGAGGTGGCAGG + Intronic
1104085423 12:125470413-125470435 GAGAGGTAGCAGGAGAGGGCAGG - Intronic
1104168967 12:126261312-126261334 GAGAGAGAGAAGGAGGTGCCAGG - Intergenic
1104814211 12:131636726-131636748 GTGTGTGAGGAGGAGCTGGCAGG + Intergenic
1104870871 12:131994488-131994510 GAGTGTTAGGCTGATGTGGCTGG + Intronic
1104918344 12:132277992-132278014 GGGAGTGAGGGGGAGGGGGCCGG - Intronic
1104946734 12:132417976-132417998 GAGAGCCAGGAGGAGCAGGCGGG - Intergenic
1105332360 13:19429691-19429713 CAGAGTCGGGAGGGGGTGGCAGG + Intronic
1105786866 13:23758810-23758832 GAGGGTGAGGTGGAGGTGGGAGG + Intronic
1105879321 13:24590103-24590125 CGGAGTGAGGAGGGGGTGGCAGG - Intergenic
1105920514 13:24958955-24958977 CAGAGTGGGGAGGGGGTGGCAGG + Intergenic
1106255587 13:28019648-28019670 GACAGGCAGGAGGAGGAGGCAGG - Intronic
1106335271 13:28777974-28777996 GAGGCTCAGGAGAAGGTGGCAGG + Intergenic
1106391462 13:29339037-29339059 GAGGCTCAGGAGAAGGTGGCAGG + Intronic
1106522635 13:30511391-30511413 GAGAGAGATGAGGAGGTGCCAGG - Intronic
1106543944 13:30714562-30714584 GAGAGCTTGGTGGAGGTGGGAGG + Intronic
1106642632 13:31600481-31600503 GTGAGTTAGGAGGAAGTGCTGGG - Intergenic
1106653835 13:31721053-31721075 GAGAAAAAGGAGGAGGTGCCAGG - Intergenic
1107268267 13:38583300-38583322 GAGAGGTTGGAGGAGGGGGCAGG + Intergenic
1107607883 13:42079672-42079694 CAAAGTTAGGAGGTGGTGGGAGG - Intronic
1107701740 13:43055340-43055362 GGGAGTTAGTGGCAGGTGGCGGG - Intronic
1107762202 13:43691810-43691832 GCTAGTTAGGAGGCTGTGGCAGG - Intronic
1108207558 13:48106305-48106327 GAGAGAGAGGAGGAGGTGCCAGG + Intergenic
1108392846 13:49964645-49964667 GAGAGAGGGGAGGAGGTGCCGGG - Intergenic
1108531470 13:51330999-51331021 CAGAGGTGGGAGGAGGTGGGAGG - Intergenic
1108605112 13:52029825-52029847 GAGAGTGAGGAAGAGGAGGGAGG + Exonic
1108770370 13:53693481-53693503 GAAAGAGAGGAGGAGGTGCCAGG - Intergenic
1109381546 13:61568123-61568145 GTGAGTTGGGAGGAGGGGGGAGG - Intergenic
1109534612 13:63700021-63700043 GATACTTTGGTGGAGGTGGCAGG + Intergenic
1109973130 13:69796444-69796466 GAGAGACAGGAGCAGGTGTCAGG - Intronic
1111179976 13:84651568-84651590 GAGAGAGAGGAGGAGGTGCCAGG - Intergenic
1111961544 13:94816138-94816160 AAGAATTAGGAGGAGGGGCCAGG + Intergenic
1112182929 13:97103195-97103217 GAGAGAAAGCAGGAGGTGTCAGG + Intergenic
1112716276 13:102189853-102189875 GAGAGCAGGGAGGAGGTGCCAGG + Intronic
1113259722 13:108548263-108548285 GAGAGTTAGGATGATGATGCTGG + Intergenic
1113735373 13:112674774-112674796 GAGAGGTGGGAGCAGGTGGGAGG + Intronic
1113759982 13:112840396-112840418 GAGAGTAAGGAGGCTGAGGCAGG - Intronic
1114222003 14:20705010-20705032 GAGAGGTAGCAGAAGGGGGCAGG - Intergenic
1114400409 14:22405135-22405157 GAGAGAGAGGAGGAGGTACCAGG - Intergenic
1114455635 14:22851534-22851556 GTGAGTGAGCAGGATGTGGCCGG - Intergenic
1114796086 14:25716672-25716694 GAGGGTTGAGAGGAGGAGGCAGG + Intergenic
1114823771 14:26052867-26052889 GAAAGAAAGGAGGAGGTGCCAGG - Intergenic
1115500767 14:34047547-34047569 GAGAGAGAGGAGAAGGTGCCAGG + Intronic
1115573194 14:34686398-34686420 GTGAGGAAGAAGGAGGTGGCAGG + Intergenic
1115903650 14:38183185-38183207 GAGAGAGAGGAGGAGGTGCCAGG + Intergenic
1116598755 14:46890120-46890142 GGAAGTGAGCAGGAGGTGGCTGG - Intronic
1116979819 14:51156643-51156665 GAGAGTGAGGAGGAGTTTCCAGG - Intergenic
1118084966 14:62404181-62404203 GAGAGAGAGGAGGAGGTGCCAGG - Intergenic
1118306619 14:64660420-64660442 GAGAGTAAGGAGGTGGATGCAGG - Intergenic
1118616589 14:67578258-67578280 GAAAGGTGGGAGGAGGTGACTGG + Intronic
1120188921 14:81422278-81422300 GAGAAAAAGGAGGAGGTGCCAGG - Intronic
1120192624 14:81452943-81452965 GAGAGTTGGGAGGGTGGGGCAGG + Intergenic
1120715938 14:87840760-87840782 GAGAGAGAAGAGGAGGTGCCAGG + Intronic
1120738287 14:88079408-88079430 GATAGTTAGGATGTGGTGGGCGG + Intergenic
1120755062 14:88235167-88235189 GAGAGTTAGGATGTGCTGTCTGG + Intronic
1120897629 14:89547990-89548012 GAGAGAAAGTAGGAGGTGGAAGG + Intronic
1121533834 14:94677562-94677584 GAGAGGCAGGAGGAGGAAGCAGG + Intergenic
1121637781 14:95465490-95465512 GTGAGTGAGGAAGAGGTGGCTGG + Intronic
1122357156 14:101130130-101130152 GAGACAAGGGAGGAGGTGGCAGG + Intergenic
1123909838 15:24955712-24955734 GAGAGTCCGTAGGAAGTGGCTGG + Intronic
1124716840 15:32071664-32071686 GAGAGAGAGGAGGAGGTGCCAGG - Intronic
1124914960 15:33961245-33961267 GAGATTTAGGAGGCTGAGGCAGG - Intronic
1124971889 15:34496300-34496322 GGGGGCTGGGAGGAGGTGGCTGG - Intergenic
1125403254 15:39326755-39326777 GAGAGTTATGAGCAGATGGAGGG - Intergenic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1125613553 15:40989724-40989746 GAGAGTTTGGACATGGTGGCAGG - Intronic
1125842831 15:42820937-42820959 GCTATTTAGGAGGATGTGGCAGG + Intronic
1127305095 15:57697641-57697663 GAGAGTTGAGGGGAGCTGGCTGG - Intronic
1127377883 15:58401758-58401780 GAGAGTTGGGTGGGGGAGGCGGG + Intronic
1127377975 15:58402447-58402469 GAGAGTTGGGTGGGGGAGGCAGG - Intronic
1127782029 15:62325439-62325461 GAGAGGAAGGAGGAGGAGGGAGG + Intergenic
1127843378 15:62848871-62848893 GAGAGTTACCAGGAGGTGGCAGG - Intergenic
1128427335 15:67555279-67555301 GAGAGAGTGGAGGAGGTGCCAGG + Intronic
1128467458 15:67924903-67924925 GAGAGAGAGAAGGAGGTGCCAGG + Intergenic
1128520365 15:68370848-68370870 GATGGTTGGGAGGAGGTGGCCGG + Intronic
1128565352 15:68697509-68697531 GAGAGTGGTGAGGAGGTGACTGG + Intronic
1128610715 15:69070993-69071015 GAGAGGGAGGAAGAGGTGCCAGG + Intergenic
1128732482 15:70030656-70030678 CAGAGGGAGAAGGAGGTGGCTGG - Intergenic
1128750595 15:70146271-70146293 GAGAGAGAGGAGGAGGTGCCAGG + Intergenic
1128793262 15:70448477-70448499 GATAGTGAGGAGGAGGTGAGGGG - Intergenic
1129498040 15:76005821-76005843 GAGAAAGAGGAGGAGTTGGCAGG + Intronic
1129684637 15:77678004-77678026 GAGCTTTCTGAGGAGGTGGCAGG - Intronic
1129946401 15:79542642-79542664 GATCATCAGGAGGAGGTGGCTGG + Intergenic
1129953017 15:79608596-79608618 GAGAGGTAGGAGGTGGTGCCTGG - Intergenic
1130136977 15:81189599-81189621 GTGAGTTGGGAGGGGGTGTCAGG + Intronic
1130324681 15:82870372-82870394 GAGAGGGAGGAGGAAGAGGCTGG - Intronic
1130349130 15:83075080-83075102 GAGAGAGGGGAGGAGGTGCCAGG + Intergenic
1130747203 15:86668036-86668058 GAGAGAGAGGAGCAGGTGCCAGG + Intronic
1132216039 15:100062307-100062329 CCAAGCTAGGAGGAGGTGGCAGG + Intronic
1132873985 16:2127910-2127932 GAGAGGTGGGAGGGGCTGGCAGG + Intronic
1132873996 16:2127937-2127959 GAGAGGTGGGAGGGGCTGGCAGG + Intronic
1132874007 16:2127964-2127986 GAGAGGTGGGAGGGGCTGGCAGG + Intronic
1132874018 16:2127991-2128013 GAGAGGTGGGAGGGGCTGGCAGG + Intronic
1132874029 16:2128018-2128040 GAGAGGTGGGAGGGGCTGGCAGG + Intronic
1132874040 16:2128045-2128067 GAGAGGTGGGAGGGGCTGGCAGG + Intronic
1132874062 16:2128098-2128120 GAGAGGTGGGAGGGGCTGGCAGG + Intronic
1132874073 16:2128125-2128147 GAGAGGTGGGAGGGGCTGGCAGG + Intronic
1132874084 16:2128152-2128174 GAGAGGTGGGAGGGGCTGGCAGG + Intronic
1132874095 16:2128179-2128201 GAGAGGTGGGAGGGGCTGGCAGG + Intronic
1132874106 16:2128206-2128228 GAGAGGTGGGAGGGGCTGGCAGG + Intronic
1132874117 16:2128233-2128255 GAGAGGTGGGAGGGGCTGGCAGG + Intronic
1132874128 16:2128260-2128282 GAGAGGTGGGAGGGGCTGGCAGG + Intronic
1132874139 16:2128287-2128309 GAGAGGTGGGAGGGGCTGGCAGG + Intronic
1132874150 16:2128314-2128336 GAGAGGTGGGAGGGGCTGGCAGG + Intronic
1132906749 16:2286425-2286447 TAGATTTAGGAGGAGAAGGCAGG + Intronic
1133009127 16:2900630-2900652 GGGAGTGAGGAAGAGGAGGCCGG + Intergenic
1133035769 16:3033336-3033358 GGGACTCAGGAGAAGGTGGCTGG + Intronic
1133071742 16:3251076-3251098 GTGAGGTGGGAGGAGGTAGCAGG - Intronic
1133535838 16:6701592-6701614 GTGAGAGAGGAGGAGGTGCCAGG + Intronic
1134001969 16:10789894-10789916 GAGGGGCAGGAGGAGGGGGCTGG + Intronic
1134099327 16:11440627-11440649 GAGATGTCTGAGGAGGTGGCAGG - Intronic
1134553072 16:15147084-15147106 GAGAGGTGGGAGGGGCTGGCAGG + Intergenic
1134553083 16:15147111-15147133 GAGAGGTGGGAGGGGCTGGCAGG + Intergenic
1134553094 16:15147138-15147160 GAGAGGTGGGAGGGGCTGGCAGG + Intergenic
1134594206 16:15482474-15482496 GAGACTTTGGAGGAGGAGCCTGG + Intronic
1134741490 16:16551054-16551076 GAGAGAGAGGAGGAGATGCCAGG + Intergenic
1134842746 16:17414751-17414773 CACAGTGAGGAGGTGGTGGCAGG - Intronic
1134926068 16:18161376-18161398 GAGAGAGAGGAGGAGATGCCAGG - Intergenic
1135059000 16:19255138-19255160 GAGACTCAGGAGCAGGTGGGAGG - Intronic
1135066565 16:19314982-19315004 GAGAGGAAGGAGGAGGGGGTGGG + Intronic
1135082246 16:19446083-19446105 AAGAGTTGGGGGGAGGTGGAGGG + Intronic
1135684719 16:24489619-24489641 GAGAGAGAGGAGGAGATGCCAGG - Intergenic
1135933846 16:26762343-26762365 GAGAGAGAGGAAGAGGTGCCAGG + Intergenic
1137413104 16:48245888-48245910 TAGAGTTAGGAATAGGAGGCGGG - Intronic
1137585900 16:49664052-49664074 GACAGTGATGAGGGGGTGGCTGG - Intronic
1137667715 16:50261442-50261464 GAGAGGCAGGAGGAGGAGGCAGG + Intronic
1138170332 16:54843611-54843633 GAGAATCAGGAGGAGGGGCCAGG - Intergenic
1139120609 16:64011872-64011894 CAGAGAGAGGAGGAGGTGCCAGG - Intergenic
1139482732 16:67239478-67239500 GAGACTGAGGAAGAGGTGGCAGG + Intronic
1139928215 16:70503888-70503910 AAGAGTAAGTAGGAGTTGGCCGG - Intronic
1140478415 16:75250348-75250370 GAGAGTTGGGTGGTGGGGGCTGG - Intronic
1140944904 16:79758709-79758731 GAGAGAAAGGAGGACGGGGCAGG + Intergenic
1141045870 16:80715767-80715789 GAGAGTGAGGAGGAGATGGAAGG - Intronic
1141204929 16:81926191-81926213 GAGAGTTAGGAGGTGATGTCTGG + Intronic
1141206070 16:81934014-81934036 GAGAGTTATGACGAGGATGCTGG + Intronic
1141210164 16:81972356-81972378 GAGAGGTAAGAGGAGGGGGAAGG - Intergenic
1141283560 16:82650638-82650660 GAGAGGTAGGGGGATGTGGGAGG - Intronic
1141778458 16:86140482-86140504 GAGAGAGAGGAAGAGGTGCCAGG + Intergenic
1142414056 16:89931849-89931871 GGGAGAGAGGTGGAGGTGGCAGG + Intronic
1142658987 17:1414595-1414617 GAGAGTGAGGAAGATGAGGCTGG + Intergenic
1142852155 17:2709510-2709532 GAGGGGGAGGAGGAGGAGGCTGG - Intronic
1142986878 17:3700809-3700831 GAGAGAGAGGAGGAGGTACCAGG - Intergenic
1143035221 17:3991298-3991320 GAGAAAGAGGAGGAGGAGGCCGG - Intergenic
1143319996 17:6061970-6061992 GAGATTGAGGTGGAAGTGGCTGG + Intronic
1143720722 17:8807256-8807278 GAGATCTAGGATGAGGTGGAAGG + Intronic
1143760843 17:9102971-9102993 GTGACTGTGGAGGAGGTGGCAGG + Intronic
1143772640 17:9178454-9178476 GAGAATTAGGAAGAGGAGGGAGG - Intronic
1144209726 17:13003901-13003923 GAGAGGGAGCAGGAGGAGGCAGG - Intronic
1144218966 17:13082920-13082942 GAGAGAGAGGAAGAGGTGCCAGG + Intergenic
1144394748 17:14833337-14833359 CACAGTTATGAGGAAGTGGCTGG + Intergenic
1144623688 17:16833731-16833753 GAGTGTGAGGAGCAGGTGGCTGG - Intergenic
1144751688 17:17653238-17653260 GAGAGAGAGGTGGAGGTGCCAGG + Intergenic
1144882742 17:18438985-18439007 GAGTGTGAGGAGCAGGTGGCTGG + Intergenic
1145078634 17:19876147-19876169 GAGAGTAAAGAGTTGGTGGCCGG + Intergenic
1145107770 17:20134337-20134359 GGGAGTTGGGTGCAGGTGGCAGG - Intronic
1145149491 17:20505401-20505423 GAGTGTGAGGAGCAGGTGGCTGG - Intergenic
1146661006 17:34665212-34665234 GACAGAGAGGAGGAGGTGCCAGG + Intergenic
1147190493 17:38735428-38735450 GGCAGGGAGGAGGAGGTGGCTGG + Exonic
1147377054 17:40028759-40028781 GCGCGTTGGGAGGAGGTAGCAGG - Intronic
1147578022 17:41613663-41613685 GAGTGTGAGGAGCAGGTGGCTGG - Intronic
1147775434 17:42897603-42897625 AAGAGTTAGAAGGAGATGGCGGG + Intergenic
1147876850 17:43627868-43627890 GAGAGATGGGGGGAGGGGGCAGG - Intergenic
1148778642 17:50109749-50109771 GAGAGGGAGGGGGAGGAGGCTGG - Intronic
1149439676 17:56663867-56663889 GAGAGTTAGAGGGTGGGGGCTGG - Intergenic
1149677251 17:58477047-58477069 CAGCGCTGGGAGGAGGTGGCTGG - Intronic
1149712560 17:58756277-58756299 GAGGGTGAGGAGGAGGAGGAGGG + Exonic
1149866884 17:60156149-60156171 GAGAGTTTAAAGGAGGTGGATGG - Intronic
1150428931 17:65100603-65100625 GAGGGAGAGGAGGAGGTGGAGGG - Intergenic
1151077937 17:71295900-71295922 GAGAGAGAGGAGGAGGTGCCTGG + Intergenic
1152123532 17:78433113-78433135 GAGAGTGAGGAGGAGGACCCAGG + Intronic
1152144384 17:78559532-78559554 GACAGCTGGGAGGTGGTGGCTGG - Intronic
1152324019 17:79625144-79625166 GAGAGGGAGGAGGAGGAGGAGGG - Intergenic
1153522169 18:5963480-5963502 GAGGATGAGGTGGAGGTGGCAGG - Intronic
1153806470 18:8712519-8712541 AAGAGAAAGGAGGAGGAGGCGGG - Intronic
1153962368 18:10150387-10150409 GAGAGTTTGTAGGAAGTGGGTGG - Intergenic
1154310078 18:13260554-13260576 GACAATTAGTGGGAGGTGGCAGG + Intronic
1155218314 18:23662579-23662601 GAGAGGAAGGAGGAGGCGGCGGG + Intronic
1155988604 18:32256445-32256467 GAGAGGCAGGAGAAGGTGGCTGG - Intronic
1156268172 18:35507275-35507297 GAGAGTAAGGCTGAGCTGGCAGG + Intergenic
1156509257 18:37621793-37621815 GAGAGTAAGGAGGATGTGAAAGG + Intergenic
1156650465 18:39220140-39220162 AATATTTAGGAGGAGATGGCAGG + Intergenic
1156653254 18:39252346-39252368 GAGAGATTGGAGAAGGTGGGGGG - Intergenic
1157095432 18:44681954-44681976 GATAGTTGGCAGGAGGTGGGGGG - Intronic
1157581178 18:48775110-48775132 TAGAGCCAGGGGGAGGTGGCTGG - Intronic
1157768094 18:50318020-50318042 GAGAGAGAGGAGGAGGTACCAGG - Intergenic
1158182346 18:54730660-54730682 GAGAGTGAGGAGGAGGAGTCAGG - Intronic
1158311597 18:56165548-56165570 GAAAGAGAGGAGGAGGTGCCAGG + Intergenic
1158328505 18:56336275-56336297 GAGACTCAGGAGGATGAGGCAGG - Intergenic
1158403476 18:57141214-57141236 GAGAGACAGCAGGAGGTGCCAGG - Intergenic
1159915399 18:74183188-74183210 GAGAAGTAGGGGGAGGTGGGAGG - Intergenic
1160014472 18:75129592-75129614 GAGAGTCAGGAGGAGCTAGGTGG + Intergenic
1160021799 18:75187035-75187057 AGGAGTCAGGAGGAGGAGGCAGG - Intergenic
1160570535 18:79814581-79814603 CAGAGCTGGGAGGGGGTGGCAGG + Intergenic
1160574577 18:79845254-79845276 GGGGTTCAGGAGGAGGTGGCTGG + Intergenic
1160669808 19:355800-355822 GAATATTAGGAGCAGGTGGCCGG - Intergenic
1160983477 19:1827194-1827216 GAGAGTGAGGACGAGGCCGCAGG - Exonic
1161601287 19:5185129-5185151 GAGAGAGAGGCTGAGGTGGCCGG - Intronic
1161794985 19:6381286-6381308 GGGAGAGGGGAGGAGGTGGCAGG + Intronic
1162024196 19:7884528-7884550 GAGAGGGAGGAGGAGGGGGAGGG + Intergenic
1162502076 19:11059837-11059859 GAGAGTGAGGAGGAGGAAGAGGG + Exonic
1162583531 19:11545312-11545334 GAGACCCAGGTGGAGGTGGCGGG + Intronic
1162706317 19:12557436-12557458 GATAGTTTAGAGGAGGTGGGAGG + Intronic
1162818802 19:13210724-13210746 GAGAGTGAGGAGGTGGTGCATGG + Intronic
1162943516 19:14028462-14028484 CAGAGATAAGAGGAGGTTGCTGG + Intronic
1163560188 19:18014395-18014417 GAGAGTGGGGAGCAGGGGGCTGG + Intergenic
1163664595 19:18597394-18597416 GTGAGTGGGGAGGGGGTGGCAGG - Intronic
1164588304 19:29491501-29491523 GAGAGAAAGGAGGAGGTGCCAGG + Intergenic
1164592691 19:29514807-29514829 GAGAGTGAGGATGAGGAGGAAGG + Intergenic
1164657935 19:29938339-29938361 GAGAGGAAGGAGGAGGTGCCAGG + Intronic
1164685580 19:30164449-30164471 AAGAGAGAGGAGGAGGTGCCTGG - Intergenic
1164883274 19:31754583-31754605 GAGAGCAAGGAGCAGGTGCCAGG + Intergenic
1165426737 19:35750090-35750112 TAGAGTAGGGAGGAGGTGGGTGG + Intronic
1166109647 19:40614221-40614243 GAGAGTCAGAAGGGGGAGGCCGG - Intronic
1166422672 19:42651052-42651074 GAGGGTTGGGAGGGGGTGGAGGG - Intronic
1166662977 19:44659233-44659255 GACTCCTAGGAGGAGGTGGCAGG + Intronic
1167007432 19:46784968-46784990 GTGTGTTGGGAGGCGGTGGCGGG + Intronic
1167483664 19:49747656-49747678 GAGAGGTGGGAGGAAGTGGAGGG - Intronic
1167488913 19:49780712-49780734 TCAAGTTAGGAGGAGGTGGCTGG + Intronic
1167889376 19:52527605-52527627 GGGAGGTGGGAGGAGGTGGGCGG - Intergenic
1168276935 19:55284019-55284041 GAGAGAAAGGACGAGGTGGCGGG + Intronic
1168277741 19:55286521-55286543 GGGATTCAGGAGGAGGTGGAGGG + Intronic
925095609 2:1197644-1197666 GATACTTGGGAGGAGGTGGGAGG - Intronic
925307188 2:2856889-2856911 GAGAGTTCTGAGGAGGTGGATGG - Intergenic
925749866 2:7078384-7078406 CATTGTTAGGAAGAGGTGGCTGG + Intergenic
926165935 2:10522211-10522233 GAGAGGTAGGCGGAGGTAACTGG - Intergenic
926439755 2:12875459-12875481 GAGAATGAGGAGGTGGAGGCTGG + Intergenic
926561411 2:14421322-14421344 GAGAGGCTGGAGCAGGTGGCAGG + Intergenic
926777994 2:16441043-16441065 GAGTCTGAGGAGGAAGTGGCAGG + Intergenic
926842203 2:17093222-17093244 GAGAGAGAGGAGGAGATGCCAGG - Intergenic
927486194 2:23489859-23489881 AAGGGAGAGGAGGAGGTGGCTGG + Intronic
927668568 2:25049763-25049785 GAGAGTCAGGGGGAGCTGCCTGG + Intronic
927809797 2:26174487-26174509 CAGAGTTGGCATGAGGTGGCCGG - Intronic
927866864 2:26594448-26594470 GAGACTGGGGAGGAGCTGGCAGG + Intronic
927924431 2:27000623-27000645 GAGAGACAGGAGGAGGAGGAGGG + Intronic
928898636 2:36293771-36293793 GCTAGTTAGGAGGAGGGGGAGGG - Intergenic
929325968 2:40611052-40611074 GAGAAAGAGGAGGAGGTGCCGGG + Intronic
929844507 2:45508974-45508996 GTGAGTTGGGAGGTGGGGGCAGG + Intronic
931860238 2:66346779-66346801 GAGAGGTAGCAGGAGGTGAGGGG + Intergenic
932729428 2:74207904-74207926 GAGAGGGAGGAGGAGGGGGATGG - Intronic
933187798 2:79298246-79298268 GAGAGATAGGTGGAGATGCCAGG + Intronic
933703515 2:85273149-85273171 GTGAGTGAGGAGGAGGTGGGAGG - Intronic
934109111 2:88725450-88725472 GAGAGTTAGGAGGAAGGCACAGG - Intronic
934724515 2:96606972-96606994 AAGAGACAGGAGGAGGTGCCAGG + Intronic
935239266 2:101164252-101164274 GAGAGAGAGGAGGAAGTGCCAGG - Intronic
935425929 2:102918249-102918271 GAGACTTGGTCGGAGGTGGCTGG - Intergenic
935659046 2:105449704-105449726 GAGAGGTTGGAGGTGGAGGCAGG - Intergenic
935735723 2:106105376-106105398 GAAAGTGATGCGGAGGTGGCAGG + Intronic
936057086 2:109269412-109269434 AAGGGTTAGGAGGATGTGGTCGG - Intronic
936121201 2:109746843-109746865 GAGAGAGAGGAGGAGGTACCAGG - Intergenic
936223495 2:110624628-110624650 GAGAGAGAGGAGGAGGTACCAGG + Intergenic
937027301 2:118710342-118710364 GAGTGATTAGAGGAGGTGGCTGG + Intergenic
937704149 2:124898856-124898878 TACTGTTAGGAGGAGGAGGCCGG - Intronic
938376166 2:130808194-130808216 GAGAGCCAGGAGGAGGTGGCAGG + Intergenic
938398204 2:130965870-130965892 GAGAGTTGGGAGCAGGGGGTGGG + Intronic
938935254 2:136121903-136121925 TAGAGAAAGGAGGAGGTGCCAGG + Intergenic
939099337 2:137878015-137878037 GAGAGAGAGGGGGAGGTGCCTGG + Intergenic
939571567 2:143846206-143846228 GAGAGATAGGAAGAGATGACAGG - Intergenic
939888508 2:147707684-147707706 AAGAGAGAGGAGGAGGTGCCAGG + Intergenic
940102558 2:150058394-150058416 CAGAGGTAGGAGGCGATGGCAGG + Intergenic
940261175 2:151780987-151781009 GAGAGGTAGGGGGAGGGGGAGGG + Intergenic
942044824 2:172094445-172094467 AAAAGAAAGGAGGAGGTGGCAGG - Intergenic
942789924 2:179749367-179749389 TGGAGTTTGGAGGAGGTGGAAGG - Intronic
943015084 2:182500320-182500342 GTCAGTCAGGAGGGGGTGGCAGG + Intronic
943064004 2:183068681-183068703 GAGGGATAGGGGGTGGTGGCCGG + Intergenic
943704843 2:191023466-191023488 GAGAATTGAGAGGATGTGGCAGG + Intergenic
943805630 2:192121447-192121469 GAGGGGAAGGAGGAGGTGGAAGG + Intronic
944468995 2:200033000-200033022 GGGATTTTAGAGGAGGTGGCAGG + Intergenic
944822007 2:203440879-203440901 CAGGGATAGGAGGAGGTGGGGGG + Exonic
945143584 2:206713592-206713614 TAGAGTTAGGAGGACATGGTGGG + Intronic
945538706 2:211055149-211055171 GAGAGGGAGGAGGAGGGGGAGGG + Intergenic
945617753 2:212094589-212094611 GAGAGGCAGGCGGAGGTGCCAGG - Intronic
945836630 2:214842041-214842063 AAGAGATAGGAGGAGGTACCCGG + Intergenic
946029982 2:216695820-216695842 GAGAATGGGGAGGAGGTGGAGGG + Intergenic
946148165 2:217746520-217746542 GAGACTTATCAGGAGGTGGCTGG - Intronic
946433731 2:219638874-219638896 GAGAGATGGGAGGAGGAGGTGGG + Intronic
947065904 2:226225367-226225389 GAGAGAGAGTGGGAGGTGGCAGG - Intergenic
948002197 2:234577445-234577467 GAGACAGAGGAGGAGGTGCCAGG + Intergenic
948035031 2:234851587-234851609 GAGAGAGAGGAGGAGGTGCCAGG - Intergenic
948276027 2:236709505-236709527 GAGAAATAGGACAAGGTGGCTGG + Intergenic
948295475 2:236857221-236857243 GAGAGGAAAGAGGAGGGGGCGGG - Intergenic
948295483 2:236857243-236857265 GAGAGTTAAGAGGAGGGGGCGGG - Intergenic
948347678 2:237312913-237312935 GAGAGGAAGAAGGAGGTGGGAGG - Intergenic
948462933 2:238138964-238138986 GAGAGGTGGGAGGGGGAGGCTGG + Intronic
948530427 2:238600320-238600342 GGAAGCTGGGAGGAGGTGGCGGG + Intergenic
949027489 2:241773418-241773440 GAGGGTTAGGGGCAGGTGGAGGG + Intergenic
1168792360 20:587632-587654 GTGAGTTAGGAAGTGGTGACTGG + Intergenic
1168838195 20:891693-891715 GAGATGAAGGAGGAAGTGGCTGG - Intronic
1169488742 20:6054126-6054148 GAGGGCTAGGAGGAGGTGCCAGG - Intergenic
1169563699 20:6829423-6829445 GAAAGCTAGGAGGAGATGACAGG + Intergenic
1170433572 20:16299805-16299827 GAAAGTTAAGAGGGGGAGGCAGG + Intronic
1170711898 20:18798693-18798715 GAGATGCTGGAGGAGGTGGCAGG - Intergenic
1171141445 20:22747279-22747301 GAGTCCTAGGAGGAGGTGGGGGG - Intergenic
1172299070 20:33835851-33835873 GAGAGAGAGGAGGAGGTGCCAGG + Intronic
1173058093 20:39635835-39635857 GAGAACTAGGAGGTGGTGGGAGG + Intergenic
1174819936 20:53717847-53717869 AAGAGTGAGGAGGTGCTGGCAGG - Intergenic
1174829301 20:53797971-53797993 GAGAGATAGGAAGAGGTGCCAGG - Intergenic
1175070901 20:56332945-56332967 GAGAGAAAGGAGGAGGAGCCAGG - Intergenic
1175155069 20:56965599-56965621 GAAAGTTATGAGCAGGCGGCTGG - Intergenic
1175273272 20:57749545-57749567 GAGAGATGGGAGGAGGAGGAGGG + Intergenic
1175283563 20:57821337-57821359 GAGAGTCAGGATGAGGTGGAGGG - Intergenic
1175581713 20:60104897-60104919 GAGAGAGAGAAGGAGGTGCCAGG + Intergenic
1175857570 20:62130741-62130763 GAGTGTTAGGAGGAGATGCCTGG + Intronic
1176513682 21:7767407-7767429 GAGAGGGAGGGGGAGGGGGCAGG - Intronic
1176985565 21:15431863-15431885 AAGAGAGAGGAGGAGGTGCCAGG + Intergenic
1177114842 21:17073214-17073236 GTGACTTAGGAGGCTGTGGCAGG + Intergenic
1177582824 21:23049720-23049742 GATAGATAGGAGGAGGTGTCAGG + Intergenic
1178647795 21:34397931-34397953 GAGAGGGAGGGGGAGGGGGCAGG - Intronic
1178668156 21:34566834-34566856 GCGAGAGAGGAGGAGGTGCCAGG + Intronic
1178756004 21:35350310-35350332 GAAAGTCAGCAGGAGGTGGAGGG - Intronic
1178984356 21:37290235-37290257 GAGAGTCAGGAGGAAATGGTTGG + Intergenic
1179281860 21:39940580-39940602 GAGAGGTAGGAGGAGGAGAAAGG + Intergenic
1179420516 21:41232632-41232654 GAGAGAGAGGAGGAGGTGCCTGG - Intronic
1179613369 21:42566353-42566375 CAAAGCTGGGAGGAGGTGGCTGG - Intronic
1181990690 22:26834594-26834616 GTGAGTGAAGAGGAGATGGCAGG - Intergenic
1182353291 22:29710752-29710774 GAGATTCAGGAGGAGGAAGCGGG + Intergenic
1182495194 22:30702032-30702054 AGGAGTTAGGAGGGGGAGGCAGG - Intronic
1183310786 22:37108499-37108521 GGGAGTGAGGAGCAGGTGCCAGG - Intronic
1183363265 22:37393995-37394017 GCATGTTAGGTGGAGGTGGCAGG - Intronic
1183547227 22:38460921-38460943 GAGGGTAAGGAGGAGGTGGCAGG + Intergenic
1184254819 22:43280850-43280872 GTGACTGAGGAGGAGGTGACAGG - Intronic
1184254849 22:43280971-43280993 GTGACTGAGGAGGAGGTGACAGG - Intronic
1184254878 22:43281089-43281111 GTGACTGAGGAGGAGGTGACAGG - Intronic
1184254907 22:43281207-43281229 GTGACTGAGGAGGAGGTGACAGG - Intronic
1184254937 22:43281328-43281350 GTGACTGAGGAGGAGGTGACAGG - Intronic
1184417186 22:44359206-44359228 CAGAGCCAGGGGGAGGTGGCGGG + Intergenic
1184754291 22:46507627-46507649 GCGAGGCAGGAGGAGGAGGCGGG - Intronic
1184816794 22:46878323-46878345 GAGAGAGAGAAGGAGGTGGGAGG + Intronic
1185001820 22:48250867-48250889 GAGAGTTCTGACAAGGTGGCTGG + Intergenic
1185035734 22:48475807-48475829 GAGTGTTTGGAGGAGGTCGGAGG - Intergenic
1185148742 22:49152667-49152689 GGGAGGGAGGAGGGGGTGGCAGG - Intergenic
949278557 3:2318749-2318771 GATACTTGGGAGGAGGAGGCAGG - Intronic
949307934 3:2663988-2664010 GAGAGGTAGGTGGGGGTGGTTGG + Intronic
950032174 3:9860490-9860512 GGGAGGAAGGGGGAGGTGGCAGG - Intergenic
950456810 3:13097574-13097596 GGGAGTTGGGAGGTGGGGGCTGG - Intergenic
950499666 3:13355615-13355637 GAGAGCTAGAAGGAGTTGGGAGG - Intronic
951574826 3:24102841-24102863 GAGAGAGAGAAGGAGGTGCCAGG - Intergenic
951648520 3:24921629-24921651 GAGAGTTAAGAGGAGATGGGGGG - Intergenic
952010648 3:28897164-28897186 GAAAGAGAGGAGGAGGTGCCAGG + Intergenic
952486500 3:33816853-33816875 GAGAATAAGGAGCAGATGGCAGG + Intronic
952500758 3:33959659-33959681 GAGAGGGAGGAGGAGGAAGCAGG + Intergenic
952981474 3:38739417-38739439 GAGAGGAAGGGGGAGCTGGCTGG + Intronic
953649059 3:44783382-44783404 GAGAGAGATGAGGAGGTGCCAGG + Intronic
953682506 3:45050537-45050559 AAGAGAGAGGAGGAGGTGCCAGG - Intergenic
953783553 3:45893449-45893471 GAGAGAGAAGGGGAGGTGGCTGG - Intronic
953929047 3:46996898-46996920 CAGAGGGAGGAGGGGGTGGCAGG - Intronic
954107347 3:48416410-48416432 GCCAGTGGGGAGGAGGTGGCCGG - Exonic
954788836 3:53115537-53115559 GAGAGAAAGGAAAAGGTGGCGGG - Intronic
955148544 3:56344317-56344339 GAGAATGAGGAGGAGGAGGAGGG - Intronic
955157689 3:56433384-56433406 GAGATTTAAAGGGAGGTGGCAGG + Intronic
955579346 3:60402085-60402107 AGGAGGTAGGAGGAGCTGGCAGG - Intronic
955627321 3:60932339-60932361 AAGAGATAGGAAGAGGTGGGTGG - Intronic
956168137 3:66411926-66411948 GAGAATGAGGGGGTGGTGGCGGG + Intronic
957168456 3:76706477-76706499 GAGAGTTAGGAGGCTGGGGGAGG - Intronic
957456713 3:80460462-80460484 GAGAGTCAGGGGCAGGTGCCAGG - Intergenic
957616774 3:82539176-82539198 GAGAGAGAGGAGGAGGGGTCAGG - Intergenic
958531276 3:95334081-95334103 GAGAGACGGGAGGAGGTGCCAGG - Intergenic
958906602 3:99948621-99948643 GAGAGGAAGGAGGAGGAGGAGGG + Intronic
959566313 3:107836030-107836052 GCAAGTCAGGAGGAGGTGGGAGG - Intergenic
959928058 3:111946917-111946939 GAGAGATAGAAGGAGTTAGCTGG + Intronic
960250163 3:115442953-115442975 GAGAGAGAGGAAGAGGTGCCAGG + Intergenic
960289372 3:115864693-115864715 GAGGGTTAGGAGGTGGTGCGAGG - Intronic
961037780 3:123654661-123654683 GGGGGTTAGGAGAAGGTGGAGGG - Intronic
961202831 3:125057858-125057880 GAGGATTGGGGGGAGGTGGCAGG - Intergenic
961457738 3:127032595-127032617 GAGAGGTAGGTGGAGGGTGCAGG + Exonic
961487497 3:127227240-127227262 GAGGGGGAGGAGGAGGCGGCTGG - Intergenic
961644716 3:128386753-128386775 GAGAGTGAGGAGGAGGTGCCAGG + Intronic
961865996 3:129953951-129953973 GAGAGGGAGGAGGTGGTGACAGG + Intergenic
962338652 3:134562312-134562334 GAGAGAGAGGAGCAGGAGGCTGG + Exonic
962621313 3:137182486-137182508 GAGAGGGTGGAGGAGGTGCCAGG - Intergenic
962922421 3:139963088-139963110 GAGAATGAGGAGGAGGAGGGGGG + Intronic
962978171 3:140464189-140464211 TAGAGCTAGGAGGAGGTTGGGGG + Intronic
963253228 3:143120577-143120599 GTTACTTAGGAGGAGGAGGCTGG + Intronic
963808925 3:149755720-149755742 TAGAGTCATGAGAAGGTGGCTGG - Intergenic
964459836 3:156912292-156912314 GAGACTCAGAAGGAGGAGGCTGG - Intronic
965302918 3:167025784-167025806 GAGAGAGAGGTGGAGGTAGCGGG - Intergenic
966474258 3:180325605-180325627 GAGAGTTAGGAGGGTGGGCCAGG - Intergenic
966819260 3:183912039-183912061 GAGACTCAGGAGGCTGTGGCAGG - Intergenic
967037927 3:185662010-185662032 GAGGGTTAGCAGGATGTGGCGGG + Intronic
967381434 3:188863516-188863538 CAGTGTCAGGAGGAGGGGGCTGG - Intronic
967986691 3:195100563-195100585 GGGAGAGAGGAGGAGGAGGCTGG - Intronic
968889324 4:3359256-3359278 GAGGGAGAGGAGGAGGTGGAGGG - Intronic
969334175 4:6497232-6497254 GAGAAATAGATGGAGGTGGCAGG + Intronic
969520792 4:7676752-7676774 GAGAGGAAGGAGGAGATGACAGG - Intronic
969520806 4:7676847-7676869 GAGAGGAAGGAGGAGATGACAGG - Intronic
969689114 4:8694577-8694599 GAGAGTGAGGAGGAGCAGCCGGG + Intergenic
969913557 4:10467055-10467077 GAGAGAGAGGAAGAGGTGCCAGG + Intergenic
970626313 4:17887919-17887941 GAGAATTAGGAGGGGTTGCCGGG - Intronic
971559155 4:28052763-28052785 GACAGTTAGGAGGCTGAGGCAGG + Intergenic
972237121 4:37147304-37147326 GAGATTTAGGATGGGCTGGCTGG + Intergenic
972365319 4:38369018-38369040 GAGAGGTGGGATGGGGTGGCAGG - Intergenic
972850437 4:43042542-43042564 GAGAGACAGGAGGAGGAGCCAGG - Intergenic
972930378 4:44064582-44064604 GAGAGAGGGGAGGAGGTGCCAGG - Intergenic
973919342 4:55668950-55668972 GAGATTTTGGAGGAGGTGGGAGG + Intergenic
974763857 4:66314566-66314588 GGGAGTTAGGAGGCTGAGGCAGG - Intergenic
975833833 4:78399628-78399650 AACAGTTAGGAGTAGCTGGCTGG - Intronic
976132830 4:81903382-81903404 GAGAGTGAGGAGGAGAGGGCTGG - Intronic
976575860 4:86670362-86670384 GGGGGTTAGGAGGTGGTGGCAGG - Intronic
976779060 4:88738385-88738407 GAGGGATGGGAGCAGGTGGCTGG + Intronic
977371685 4:96145189-96145211 GAGACCTGGGTGGAGGTGGCTGG - Intergenic
977587302 4:98787817-98787839 GAGAGTTAGGTGGAGAAGGAAGG + Intergenic
977609849 4:99020482-99020504 GAGCCTGAGGAGGAGGAGGCGGG + Intronic
978086024 4:104656474-104656496 GGGAGTTAGGGGGATTTGGCTGG + Intergenic
978299314 4:107248645-107248667 TGGAGTTAGGAGGAGGTTTCAGG - Intronic
979234539 4:118385074-118385096 GAGAGAGAGGAGGAGATGCCAGG - Intergenic
979876708 4:125900686-125900708 GAGAGAGAGGAGGAAGTGCCAGG + Intergenic
980463967 4:133150778-133150800 GAGAAGGAGGGGGAGGTGGCGGG + Exonic
981194104 4:141898523-141898545 GAGAGAAAGGAGGAAGTGCCAGG - Intergenic
981420045 4:144538976-144538998 GTGAGTTGAGAGGAGCTGGCAGG - Intergenic
981825488 4:148935905-148935927 GAGAGAGAGGAGGAGGAGCCGGG - Intergenic
981906362 4:149925700-149925722 GAGAGAGAGGAGGAGGTGCCAGG - Intergenic
982140311 4:152311038-152311060 GAAAGTTAGGAGGAGGTGATGGG + Intergenic
982400634 4:154963891-154963913 GAGAGAGAGGAGGTGGTGCCAGG - Intergenic
982871889 4:160590042-160590064 GAAAGAGAGGAGGAGGTGCCAGG + Intergenic
983118210 4:163846491-163846513 GAGAGTGAGGAGGATGTCACTGG + Intronic
984811019 4:183797081-183797103 GAGAGGTGGGAGGTGGGGGCAGG + Intergenic
985286763 4:188344239-188344261 GAGAGTAAGTAGGAGTGGGCGGG + Intergenic
985781359 5:1873614-1873636 GAGACCTAGTAGTAGGTGGCAGG - Intergenic
986286070 5:6360075-6360097 GAGAGCTGGAAGGAGGAGGCAGG + Intergenic
986399605 5:7368210-7368232 GAGAGAGAGGAGGAGGTATCGGG - Intergenic
986429193 5:7664979-7665001 CAAAGTGAGGAGGAGGGGGCGGG - Intronic
988775943 5:34478139-34478161 GAGAGAGGGGAGGAGGTGCCAGG - Intergenic
989189557 5:38657152-38657174 GAGAGTGAGGAGGGAGTGGCAGG - Intergenic
991259497 5:64651381-64651403 GAGAGAGAGAAGGAGGTGCCAGG - Intergenic
991605955 5:68401402-68401424 GAGAGAGAGGGGGAGGTGCCAGG + Intergenic
992090625 5:73312877-73312899 GAGGGGGAGGAGGAGGAGGCAGG - Intergenic
994309595 5:98252933-98252955 AAGAGAGAGGAGGAGGTGCCAGG + Intergenic
994869686 5:105331632-105331654 GAGAGGGAGGAGGAGGAGGGAGG + Intergenic
995133727 5:108658472-108658494 GAGAGTCAGGAGGAGTTGTCTGG + Intergenic
995856355 5:116597067-116597089 GAGAGAGAGGAGGAGGAGCCAGG - Intergenic
996393630 5:122990048-122990070 GAAAGTTAGGAGGAGGGGCTTGG - Intronic
996527484 5:124494072-124494094 GACAGCTAGGAGGCTGTGGCTGG + Intergenic
997111156 5:131076078-131076100 GAGAGAGAGGAGGAGGTGCCAGG + Intergenic
998524672 5:142831647-142831669 GAGAGGGAGGAGGAGGAGGAGGG - Intronic
998781382 5:145660419-145660441 GAGGGTTAGGAGGAGGAGCCAGG - Intronic
999336379 5:150721151-150721173 GTGAGTTAGGAGGAGCTAGGAGG - Intronic
1000199917 5:158997994-158998016 CAGAATGAGGAGGAGGTAGCAGG - Intronic
1001110690 5:168893712-168893734 GTGAGTGAGGGGGAGGTGGCAGG + Intronic
1001184582 5:169556646-169556668 GAGAAGGAGGAAGAGGTGGCAGG - Intergenic
1001613259 5:173021168-173021190 GAGAGAGAGAAGGAGGTGCCAGG + Intronic
1002530480 5:179841603-179841625 GAGAGGTCGGAGTAGCTGGCAGG - Intronic
1002904895 6:1440314-1440336 GAAAGTTTGGAGGAGGGGACTGG + Intergenic
1003318775 6:5034546-5034568 GAGAGAGAGGAGGAGATGCCAGG - Intergenic
1004014837 6:11722892-11722914 CTGAGTTGGGAGGAGGTGGGAGG + Intronic
1004017339 6:11744144-11744166 GAGAGAGGGGAGGAGGTGCCAGG - Intronic
1005223927 6:23620001-23620023 GAGAGAGAGGGGGAGGGGGCGGG + Intergenic
1005339658 6:24831368-24831390 GGGAGGTAGCAGCAGGTGGCTGG + Intronic
1005471179 6:26164166-26164188 CAGTGGTAGCAGGAGGTGGCAGG + Intronic
1005893474 6:30158828-30158850 GAGGTGTAGGAGGAGGTGGTGGG + Intronic
1006833700 6:36984666-36984688 GAGAATTAGGTGGGTGTGGCTGG - Intronic
1007267895 6:40611027-40611049 GAGAGTAATTAGGAGGGGGCCGG - Intergenic
1007309814 6:40936423-40936445 AAGGGACAGGAGGAGGTGGCTGG - Intergenic
1007359253 6:41343283-41343305 TATAGATAGGAGGAGGAGGCAGG - Intronic
1007694662 6:43724683-43724705 GAGACTAAGGAGCAGGAGGCAGG - Intergenic
1007811907 6:44492227-44492249 GTGAGTGGGGAGGAGGTGCCAGG - Intergenic
1008102196 6:47404011-47404033 GTGAGATATGAGGAGGTGGATGG - Intergenic
1008908880 6:56711793-56711815 TAAAAATAGGAGGAGGTGGCCGG + Intronic
1010022660 6:71178801-71178823 GTGAGAGAGGAGGAGGTGCCAGG - Intergenic
1010752497 6:79631241-79631263 GAGAGGGAGGAGGAGGGAGCCGG - Intergenic
1010887375 6:81261578-81261600 GAGGTTTAGGAGGAGGAGGGAGG + Intergenic
1011749024 6:90436706-90436728 GAGAGAAAGGGGGAGGTGCCAGG - Intergenic
1012367158 6:98455656-98455678 GCGAGTTGGGGGGAGGGGGCAGG - Intergenic
1012369877 6:98490811-98490833 GATAGTTTGGAGGAGGTAGAAGG + Intergenic
1012816503 6:104028546-104028568 TAGTTTTAGGAGAAGGTGGCAGG - Intergenic
1012834710 6:104251101-104251123 AAGAGTTTGGAGGAGCAGGCTGG + Intergenic
1013015552 6:106157849-106157871 GAGAGTTTGGAGGCTGGGGCAGG - Intergenic
1013132110 6:107242901-107242923 AAGGGCTATGAGGAGGTGGCAGG + Intronic
1013427988 6:110032516-110032538 GAGAGAGGGGAGGAGGTGGCTGG + Intergenic
1013660712 6:112293935-112293957 GAGATTTATGAGGAGATGTCAGG + Intergenic
1014300660 6:119677484-119677506 GAGAGGTGGGAGGAGCAGGCAGG - Intergenic
1014804868 6:125818095-125818117 GAAAGTAAGGAGGAGGAGGAAGG - Intronic
1015143184 6:129958375-129958397 GGGAGTGAGGAGGAGGTAGGAGG + Intergenic
1015489872 6:133812842-133812864 GAGAGAGAGGAGGAGGTGCCAGG + Intergenic
1015496461 6:133888905-133888927 CACAGTTGGGAGAAGGTGGCTGG + Intergenic
1015636443 6:135279527-135279549 GGGAGTTGGCAGGAGGAGGCAGG + Intergenic
1015915095 6:138208257-138208279 TAAAGTTAAGAGGAGGTAGCAGG - Intronic
1016168915 6:140983812-140983834 GAGAATGAGGAAGAGGTTGCAGG - Intergenic
1016208533 6:141500912-141500934 GAGATTTGGGAGGGGGTGGTTGG - Intergenic
1016363727 6:143293921-143293943 GAGAGTGAGGTGGAGGTGGAGGG - Intronic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1017184022 6:151582755-151582777 GAGAGAGAGGAGGAGGTGCCAGG + Intronic
1017645261 6:156534144-156534166 GGGAGGTAGGTGGAGGAGGCTGG - Intergenic
1017858882 6:158376730-158376752 GAGACATAGGAGAAGTTGGCTGG + Intronic
1017996290 6:159534271-159534293 GGGAGTGAGGAGGACGAGGCTGG + Intergenic
1018025229 6:159800436-159800458 GAGCTTGAGGAGGGGGTGGCGGG + Intronic
1018267343 6:162039495-162039517 GAGAGAGAGAAGGAGGTGCCAGG - Intronic
1018366198 6:163122534-163122556 GAGAGCGAGGGGGAGGTGCCAGG - Intronic
1018688864 6:166327263-166327285 GTGAGTTAGGAGGCAGAGGCAGG + Intronic
1019551828 7:1606909-1606931 GAGGGGTAGGAGGAGGGGGAGGG - Intergenic
1019623227 7:2002714-2002736 GCCTGTTAGGAGGAGGCGGCTGG - Intronic
1020139745 7:5605872-5605894 GGGGGCTGGGAGGAGGTGGCTGG - Exonic
1021052959 7:16012173-16012195 GAGGGTTAGGAGGAGGGTGAGGG - Intergenic
1022886617 7:34653338-34653360 GAGAGAAAGGAGGAGGTGCCAGG + Intergenic
1023192123 7:37593952-37593974 GAGAGAGAGGAGGAGGTTGTGGG - Intergenic
1023792389 7:43763208-43763230 CAGAGCTGGGAGGAGGGGGCTGG + Intronic
1024178141 7:46861785-46861807 GAGAGTTAAGAGGAGGAGGGTGG + Intergenic
1025002485 7:55328362-55328384 GAGAGAGAGGAAGAGGTGACAGG - Intergenic
1025215388 7:57051679-57051701 GAAAGAGAGGAGGAGGTGCCAGG - Intergenic
1025626132 7:63224101-63224123 GAGAGAGAGGAGGAGGTGCCAGG - Intergenic
1026159064 7:67852834-67852856 GAGAGAAAGGAGGAGGAGGAGGG + Intergenic
1026366758 7:69656028-69656050 GATAGTGATGAGGTGGTGGCAGG + Intronic
1026471079 7:70694493-70694515 GAGAGGGAGGAGGAGGAGGAGGG - Intronic
1026800648 7:73397867-73397889 AAGAGTGAGGAGGAGGCGGGGGG + Intergenic
1026885812 7:73943812-73943834 AATAGAGAGGAGGAGGTGGCAGG + Intergenic
1026939755 7:74280683-74280705 GAGAGAGAGGAGGAGGAGGCTGG - Intergenic
1027190066 7:75991345-75991367 GAGAGGTAGCAGCAGGTGGACGG - Intronic
1027508573 7:79050492-79050514 GCGAATTTGGAGGATGTGGCAGG - Intronic
1029198838 7:98825445-98825467 GAGAGTGAGGAGGAGGTGCCAGG - Intergenic
1029601473 7:101565947-101565969 GAGATTTAGTAGGAGTTGTCTGG + Intergenic
1030735383 7:113041957-113041979 GAGATTTAGGAGGAAGAGGTGGG + Intergenic
1032122009 7:129163433-129163455 GAGACTTAGGAGATGGAGGCAGG - Intronic
1032201474 7:129825641-129825663 GAGAGTTTGGTGGCCGTGGCTGG + Intergenic
1032474763 7:132204193-132204215 GAGAGATAGGAGGTGGAGGGTGG + Intronic
1032741387 7:134742868-134742890 GAGAGATTGTGGGAGGTGGCAGG + Intergenic
1034065874 7:148136070-148136092 GAGAGGGAGGGGGAGGTGGAAGG + Intronic
1034380460 7:150687875-150687897 GAGAGTGAGGAGGAGGGAGTGGG - Intronic
1034903077 7:154919928-154919950 GAGAGGGAGGAGGAGGTGCCAGG + Intergenic
1035161138 7:156950509-156950531 GAAAGTGAGGAGGAGGAGGAGGG + Exonic
1035311087 7:157969507-157969529 GGGAGCTGGGAGGTGGTGGCAGG + Intronic
1035375029 7:158402111-158402133 GTGTGTTTGGAGGGGGTGGCTGG - Intronic
1035658547 8:1330133-1330155 GGGAGTGAGGAGGTGGTGGCAGG + Intergenic
1036757002 8:11477385-11477407 GAGAGGAAGGAGGGGGTGGGTGG - Intergenic
1037144199 8:15553750-15553772 GAGAGTTAAGTGGTGGTAGCTGG + Intronic
1037147638 8:15592529-15592551 GAGAGTTAGGAGGAGGTGGCAGG - Intronic
1037587479 8:20288040-20288062 GAGAGGCAGGAGGTGGGGGCTGG - Intronic
1038016865 8:23522994-23523016 GCGACTTAGGAGGATGAGGCAGG - Intergenic
1038119558 8:24597412-24597434 GTGAATTAGGAGGAGTTGGATGG + Intergenic
1038747702 8:30268752-30268774 GGGAGTTGGGAAGAGGTGGCTGG - Intergenic
1039471964 8:37819017-37819039 GCGAGCCAGGGGGAGGTGGCAGG + Intronic
1039681104 8:39737422-39737444 GAGACATAGGGGGAGGTGCCAGG + Intergenic
1040393300 8:46968751-46968773 GAGGGAAAGGAGGAGGTGCCAGG - Intergenic
1041479446 8:58302592-58302614 GAGAAGGAGGAGGAGGTGGAGGG + Intergenic
1042032238 8:64489040-64489062 GAGAGAGAGGAGGAGGAGTCAGG + Intergenic
1042827489 8:72993444-72993466 GAGAGGTAGGGGAAGTTGGCTGG + Intergenic
1043762972 8:84093171-84093193 GAGAGAGAGGGGGAGGTGCCAGG + Intergenic
1043920704 8:85980246-85980268 GAGAGAGAGGAGGAGGGGCCAGG - Intergenic
1044131646 8:88531060-88531082 GAGATGTAGGAGGAGGTAGTAGG + Intergenic
1044584014 8:93852141-93852163 GAGAGGGAGGAGGAGGTGCCAGG + Intergenic
1044708382 8:95030940-95030962 GAGAGAAGGGAGGAGGTGCCAGG + Intronic
1044995981 8:97838624-97838646 AACAGTTAGGAGGAGGTGAGTGG - Intronic
1046057191 8:109093202-109093224 GAGAGGGAAGAGTAGGTGGCTGG - Intronic
1046413214 8:113876121-113876143 GATAGTTAGGAGGCTGAGGCAGG + Intergenic
1046655713 8:116892048-116892070 GAGAGAAAGAAGGAGGTGTCAGG + Intergenic
1047139844 8:122125602-122125624 GAGAGAGTGGAGGAGGTGCCAGG + Intergenic
1047499369 8:125430120-125430142 GAGAGGGAGTAGGAGGTGGGGGG - Intergenic
1047549279 8:125852088-125852110 GAGAGAGGGGAGGAGGTGCCAGG - Intergenic
1047885839 8:129249204-129249226 GAGAGAAGGGAGGAGGTGCCAGG - Intergenic
1047938693 8:129806793-129806815 GAGAGAGAGGAAGAGGTGCCAGG - Intergenic
1047988726 8:130263511-130263533 GAGAGACACCAGGAGGTGGCTGG + Intronic
1049278185 8:141730384-141730406 GAGAGGAAGGAGGAGGAGGAGGG - Intergenic
1049533955 8:143169471-143169493 GAGATACAGGAGGAAGTGGCAGG - Intergenic
1049986719 9:958611-958633 GAGAGTTAGGAGGTCCAGGCGGG - Intronic
1050170423 9:2810088-2810110 GAGAGTGAGGGGGCGGTGGGGGG + Intronic
1052531191 9:29686312-29686334 GAGAGGGAGGAGGAGGGGGAGGG + Intergenic
1052951937 9:34219994-34220016 GAGGGGTAGGGGGAGGTGGGAGG - Intronic
1053434938 9:38068455-38068477 GAGAAGCAGGAGGCGGTGGCCGG + Exonic
1054852299 9:69860338-69860360 GAGAGAGGGGAGGAGGTGCCAGG + Intronic
1054973447 9:71115721-71115743 GGGAGTGAGGAGGAAATGGCTGG - Intronic
1055003716 9:71482533-71482555 TAGAGTTAGGAGAAGTTGTCTGG + Intergenic
1055298150 9:74854572-74854594 GAGAAGAAGGAGGAGGTTGCTGG - Intronic
1055434246 9:76276486-76276508 GAGAGTCAGGAGGTGATGCCAGG - Intronic
1055581428 9:77711025-77711047 GAGAGGGAGGAGGAGGAGGAGGG - Intergenic
1055596868 9:77874384-77874406 GGGAGATATGAGGAGGTGGAAGG - Intronic
1055767108 9:79675290-79675312 GAGGGTCAGGAGGAGATGGCAGG - Intronic
1055767223 9:79676505-79676527 GAGGGTCAGGAGGAGATGGCAGG + Intronic
1056184472 9:84120189-84120211 AAGAGTTAGGAGAACCTGGCCGG - Intergenic
1056401614 9:86233026-86233048 AAGAGTTATGAGGAGGGGCCGGG - Intronic
1057145882 9:92759440-92759462 TAGGGTTAGGAGGAGGTCACTGG - Intronic
1057361598 9:94378345-94378367 GAGAGAGGGGAGGAGGTGCCAGG + Intronic
1057472329 9:95368840-95368862 CAGAGTTAGGAGGAGGTGTGAGG + Intergenic
1057550504 9:96048406-96048428 GAGAGGGAGGAGGAGGTTGGGGG + Intergenic
1057661759 9:97009825-97009847 GAGAGAGGGGAGGAGGTGCCAGG - Intronic
1057762582 9:97888722-97888744 GAGATTTAGAAGGAGCTGGAGGG + Intergenic
1058052115 9:100416761-100416783 GAAAGTAAGGAAGAGCTGGCCGG - Intergenic
1058432073 9:104928357-104928379 GGGAGTTGGGGGGAGGTGGGTGG + Intergenic
1058457206 9:105148668-105148690 GAAAGAAAGGAGGAGGAGGCAGG + Intergenic
1058575863 9:106400413-106400435 TAGAGATAGGAGAAGGTAGCAGG + Intergenic
1058924786 9:109652369-109652391 GAGAGAGGGGAGGAGGTGCCAGG - Intronic
1059248380 9:112867107-112867129 GGGAGTTCTGAGGAGGTGGGAGG - Intronic
1059363963 9:113770885-113770907 TAGAGTAAGGAGGTGATGGCAGG + Intergenic
1059667884 9:116466345-116466367 CAGAGATAAGAGAAGGTGGCTGG - Intronic
1060407195 9:123378633-123378655 GAGCGTGGGGAGGAGGCGGCTGG + Exonic
1061075369 9:128338167-128338189 GAGAGTTAGCGGGAGGATGCTGG - Intergenic
1061619663 9:131803647-131803669 CAGAGGTAGGAGGAGGGAGCAGG + Intergenic
1061645385 9:131996751-131996773 TAGAGTAAGGAGGAGGAGGTTGG - Intronic
1061899681 9:133666509-133666531 GAGAGGAAGGAGGAGGAGGAGGG - Intronic
1062370460 9:136236172-136236194 GGGAGTGGGGAGGAGGTGGAGGG - Intronic
1062711222 9:137976150-137976172 GACAGTGAGGAGCAGGGGGCTGG + Intronic
1062744610 9:138203433-138203455 GAGAATTAGGAAGAGGAGGAGGG + Intergenic
1185556667 X:1026921-1026943 GAGAGGGAGGAGGAGGAGGAGGG - Intergenic
1185575540 X:1169189-1169211 GGGAGGGAGGAGGAGGTGGAGGG + Intergenic
1185745563 X:2569932-2569954 GAGAGAGAGGAGGAGGAGCCAGG + Intergenic
1186020673 X:5251402-5251424 GAGAGAAAGTAGGAGGTGACTGG + Intergenic
1186149332 X:6657594-6657616 GAGAGAGAGGAGGAGGTGCCAGG - Intergenic
1186611116 X:11139215-11139237 GAGAGTGAGCTGGATGTGGCCGG - Exonic
1186687994 X:11945673-11945695 GAGAGAGAGGAGTAGGTGCCAGG + Intergenic
1186880156 X:13857078-13857100 GAGAGTTAGAAGGAGATGTGAGG - Intronic
1186974970 X:14892342-14892364 GAGAGAAAGGAGGAGGTGCCAGG + Intronic
1187045886 X:15647168-15647190 GAGGCTCAGGAGGTGGTGGCAGG - Intronic
1187051864 X:15703469-15703491 GAGGCTCAGGAGGTGGTGGCAGG - Intronic
1187275479 X:17813245-17813267 GAGAGATTGGAGGAGCTGGCGGG - Intronic
1187289560 X:17940050-17940072 GAGGGAGAGGAGGAGGTGTCAGG - Intergenic
1187377096 X:18764689-18764711 GTGAGGAAGGAGGAGGGGGCAGG + Intronic
1187717230 X:22114751-22114773 GAGAGTGAGGATGAGTTAGCAGG + Intronic
1189351998 X:40282609-40282631 GAATGTTAGGATGAGATGGCTGG + Intergenic
1189479869 X:41384271-41384293 GATATTTAGGAGGAAGTAGCTGG - Intergenic
1189687179 X:43576594-43576616 AAGAGTTGGGAGGATGTGGGTGG + Intergenic
1190154025 X:47973255-47973277 GGGAGTTGGGTGGAGGTGGGAGG - Intronic
1190463152 X:50698907-50698929 CAGAGTTAGGAGGAGGAAGGTGG - Intronic
1192079611 X:68033836-68033858 GAGAAAGAGGAGGAGGTGCCAGG - Intergenic
1192207288 X:69105000-69105022 GAGAGGCAGGGGGAGGGGGCCGG + Intergenic
1192216467 X:69162844-69162866 GATAGTGAGGAGGAGGGGGCTGG - Exonic
1192217954 X:69177116-69177138 GAAGGGAAGGAGGAGGTGGCAGG - Intergenic
1192555953 X:72089442-72089464 GAGGGCTTGTAGGAGGTGGCTGG + Intergenic
1194580437 X:95665318-95665340 GAGAGTGAGGAGAAGCTGGGTGG + Intergenic
1194729790 X:97439830-97439852 GAAAGTCAGGAGCAGGTGGGTGG + Intronic
1194764319 X:97831538-97831560 GAGAGAGAAGAGGAGGTGCCAGG - Intergenic
1194825037 X:98551117-98551139 GAGAGAGAGGAGGAGGTGCCAGG - Intergenic
1195737054 X:108022884-108022906 GAGAGATGGGTGGAGGTGCCAGG - Intergenic
1197507065 X:127319005-127319027 GAGAGATAGGAGGCAGTGGTGGG + Intergenic
1197744374 X:129921263-129921285 GAGAGTGAGGAAGAGGAGGGAGG + Exonic
1197865540 X:131012792-131012814 GGGAGTGAGGAGGAAGTGGTTGG + Intergenic
1198264947 X:135000259-135000281 GAGAGAGAGAAGGAGGTGCCAGG - Intergenic
1198367079 X:135951666-135951688 CAGAGTCAGGAGGAGATGGATGG + Intergenic
1199265077 X:145819107-145819129 GAGAGAAAGGTGGAGGTGGTTGG - Exonic
1199278666 X:145974564-145974586 TAGAGGAAGGTGGAGGTGGCGGG - Intergenic
1199502813 X:148527746-148527768 TAGAATGAGGATGAGGTGGCGGG - Intronic
1200142391 X:153908609-153908631 GGGAGGCAGGAGGGGGTGGCTGG - Intronic
1200219408 X:154383783-154383805 GGGAGTAAAGAGGAGGTAGCTGG + Intergenic
1200257826 X:154594163-154594185 GAGAGAGAGAAGGAGGTGCCAGG - Intergenic
1201438481 Y:13985116-13985138 GGGAGGTAGGAAGAGGTGGTGGG - Intergenic
1201446092 Y:14057592-14057614 GGGAGGTAGGAAGAGGTGGTGGG + Intergenic
1201546993 Y:15176264-15176286 GAGAGGAAGCAGTAGGTGGCTGG - Intergenic
1202593925 Y:26516373-26516395 GAGAGTAAGGAGGTGGTGGAGGG + Intergenic