ID: 1037156804

View in Genome Browser
Species Human (GRCh38)
Location 8:15710622-15710644
Sequence CTGCATTTTAATAAGTAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 410
Summary {0: 1, 1: 0, 2: 6, 3: 48, 4: 355}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037156804_1037156806 -8 Left 1037156804 8:15710622-15710644 CCAGGCTACTTATTAAAATGCAG 0: 1
1: 0
2: 6
3: 48
4: 355
Right 1037156806 8:15710637-15710659 AAATGCAGATTGCAGAAAATGGG No data
1037156804_1037156805 -9 Left 1037156804 8:15710622-15710644 CCAGGCTACTTATTAAAATGCAG 0: 1
1: 0
2: 6
3: 48
4: 355
Right 1037156805 8:15710636-15710658 AAAATGCAGATTGCAGAAAATGG No data
1037156804_1037156808 27 Left 1037156804 8:15710622-15710644 CCAGGCTACTTATTAAAATGCAG 0: 1
1: 0
2: 6
3: 48
4: 355
Right 1037156808 8:15710672-15710694 ACCTTTGTAGCAAGATTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037156804 Original CRISPR CTGCATTTTAATAAGTAGCC TGG (reversed) Intronic
902132444 1:14274489-14274511 CTGCATTTTATTAAGCTCCCCGG - Intergenic
902852961 1:19175952-19175974 AATTATTTTAATAAGTAGCCGGG - Intronic
903429320 1:23280579-23280601 CTGCATTTTAACAAGATCCCTGG + Intergenic
904780032 1:32939472-32939494 ATGCATAATAATAAGTAGGCAGG - Intronic
907028287 1:51144244-51144266 CTGCATTTTAACAAGCTCCCAGG + Intronic
907553970 1:55328717-55328739 CTGCTTTTTAACAAGTCCCCAGG - Intergenic
907576857 1:55534532-55534554 CTGCATTTAAATCAGAAGCTGGG - Intergenic
907710346 1:56875156-56875178 ATGCATTTTAATAAGCTCCCTGG - Intronic
907827407 1:58032165-58032187 CTGCATTTTAACAAGACGCCAGG + Intronic
909946687 1:81671451-81671473 CTGCATTTTAACAAGATCCCTGG - Intronic
910569354 1:88683392-88683414 CTATATTTTACTAAGTAGTCAGG + Intergenic
910728811 1:90368021-90368043 CTGCATTTGAACAAGAATCCTGG - Intergenic
910872568 1:91848351-91848373 CTGCATTTTAACAAGATCCCTGG + Intronic
911594300 1:99783030-99783052 CTGCATTTTAAAAAATAGTGGGG - Intergenic
911745027 1:101432284-101432306 CTGAATATTAATAATGAGCCTGG + Intergenic
911904033 1:103542972-103542994 TTGCATATTAATAAATATCCTGG + Intronic
912361261 1:109098195-109098217 ATGTGTTTTAAAAAGTAGCCAGG + Intergenic
912566297 1:110589964-110589986 TTGCATTGCTATAAGTAGCCAGG + Intergenic
912959171 1:114180240-114180262 CTGCATTTTAAAAAGATCCCTGG + Intergenic
914672205 1:149879467-149879489 CTGCATTTTCATATGAAGCCTGG - Intronic
916208773 1:162341342-162341364 CTGTATTTTAATCTGTACCCTGG + Intronic
916589106 1:166173305-166173327 CTGCATTTTAACAAGATTCCCGG - Intergenic
917674762 1:177308350-177308372 CTGCATTTTAAGAAGTTCCCTGG - Intergenic
918145614 1:181753260-181753282 CTGGATTTTAAGAAGTACCCAGG - Intronic
918662029 1:187100930-187100952 CTGAATTTAAATAATTATCCTGG + Intergenic
919088313 1:192948133-192948155 CTGCAGTATCATAAGTCGCCAGG + Intergenic
920033923 1:203053573-203053595 CTGCATTTTAACAAGACCCCTGG - Intronic
920280538 1:204840097-204840119 CTGCATTTTAACAAGATCCCAGG - Intronic
920762387 1:208797901-208797923 CTGCATTTTAACAAGATACCGGG - Intergenic
921061149 1:211585581-211585603 CTGCATTTTCATGAGTTCCCAGG - Intergenic
921235557 1:213124107-213124129 CTGCTTTTTAACAAGTCACCTGG + Intronic
921912314 1:220562996-220563018 CTGCATTTAAGTAGGTAGCTTGG + Intronic
924270755 1:242330101-242330123 ATGCACTTTAATAAGCACCCAGG + Intronic
1063549398 10:7015484-7015506 CTTTCTTTTTATAAGTAGCCTGG - Intergenic
1063648618 10:7910749-7910771 CTGTCTTTTAGTTAGTAGCCAGG - Intronic
1064423240 10:15208271-15208293 CTAGATTTTAATAATTAGCATGG + Intergenic
1064465116 10:15571647-15571669 CTGCATTTTAACAGACAGCCAGG + Intronic
1064735483 10:18377999-18378021 CTTCATGTTAATTAGGAGCCAGG + Intronic
1064843470 10:19623802-19623824 TAGCATTTTAATCAGTAGACTGG - Intronic
1065874397 10:29984244-29984266 CTGCATTTTCATAAGATACCTGG - Intergenic
1066672472 10:37854989-37855011 CTGCATGTTAAAAAGATGCCAGG + Intronic
1066714189 10:38268757-38268779 ATGCATTTTAATAAGCACCCAGG - Intergenic
1068173788 10:53429839-53429861 CTGCATTTTAACATGTGTCCAGG + Intergenic
1068561320 10:58517689-58517711 CTACATTTTAATAGGGAGCTTGG + Intronic
1069529767 10:69208274-69208296 CTGCATTTTAACAAGATCCCTGG + Intronic
1070296610 10:75166913-75166935 CTGCATTTTAACAAGCACCCAGG - Intronic
1070336811 10:75463257-75463279 CTGCATTTTCACAAGTTCCCCGG - Intronic
1071866206 10:89735014-89735036 CTGCATTTTAATAAGGTCCCTGG + Intronic
1071925154 10:90398219-90398241 ATATATTTTAATAAATAGCCAGG - Intergenic
1072892236 10:99334110-99334132 CTGCATTTTAGCAAGCTGCCAGG + Intronic
1073335572 10:102705679-102705701 CAGCAACTTAATAAGTAGCAGGG + Intronic
1074463235 10:113657922-113657944 CAGCATTTTAATAAGCTCCCTGG - Intronic
1074963952 10:118472502-118472524 CTGCATTTTAATCAGCTCCCCGG + Intergenic
1074979257 10:118606514-118606536 CTGCATTTTAACAAGATCCCAGG + Intergenic
1075377876 10:121994103-121994125 CTACAGTTTCATCAGTAGCCAGG - Intronic
1075856698 10:125636032-125636054 ATACATTTTAAAAATTAGCCAGG - Intronic
1076253088 10:128998182-128998204 CTGTCTTTTAAGAAGAAGCCAGG - Intergenic
1076867086 10:133172840-133172862 CAACATTTTAAAAATTAGCCGGG + Intronic
1077620069 11:3713556-3713578 AAACATTTTAAAAAGTAGCCAGG + Intronic
1078155841 11:8799162-8799184 CTGAACTCTAATAAGTACCCAGG - Intronic
1078597337 11:12698759-12698781 CTGCATTTTAATAAAATTCCAGG + Intronic
1079220933 11:18560701-18560723 CTGCATTTTAATAAAATCCCTGG - Intronic
1080309584 11:30874240-30874262 CTGCATTTTAACAAGCACCTGGG - Intronic
1080563934 11:33490809-33490831 CTGCATTTTGATAAGATCCCAGG - Intergenic
1080758153 11:35221902-35221924 CTGCATCTTAACAAGTTTCCAGG + Intronic
1080952564 11:37052204-37052226 TTGCCTTTTAGTGAGTAGCCTGG + Intergenic
1081215767 11:40395676-40395698 CTGTATTTTAATAAGCACTCTGG - Intronic
1082889267 11:58121320-58121342 AGGCATTTTAATGAGTATCCTGG - Intronic
1083473300 11:62898823-62898845 CTGCATTTTAATGAGATCCCAGG + Intergenic
1084600678 11:70143608-70143630 CTGCATTTTAACAAGCTCCCTGG + Intronic
1086216287 11:84385712-84385734 TTTCAGTTTAATAAGTAGGCAGG - Intronic
1086502450 11:87467226-87467248 CTGCATTTTAAGCAGGAACCTGG + Intergenic
1086965061 11:93018976-93018998 CTGCATTTTTATCAGCATCCTGG + Intergenic
1089584395 11:119501207-119501229 CTGCATTTTGATAGGAAGGCTGG - Intergenic
1089950049 11:122517232-122517254 TTGCATTATAATAAGAAACCTGG + Intergenic
1090271020 11:125386353-125386375 CTGCATTTTAAAAAGTTTCCTGG + Intronic
1091462915 12:659374-659396 CTGCATTTTGGGAAGGAGCCAGG + Intronic
1092956006 12:13550719-13550741 CTGCATTTTAATGACTAGGATGG - Exonic
1093405080 12:18795150-18795172 TTGATTTTTATTAAGTAGCCAGG - Intergenic
1094610221 12:31988601-31988623 CTGTATTTTAATAATGAGACCGG + Intronic
1095266531 12:40165412-40165434 CTGTATTTTAATAAGAACCTTGG + Intergenic
1097998215 12:65913610-65913632 CAGCCTTTTAATAAGCAGCAGGG + Intronic
1098565180 12:71926946-71926968 CTGCATTTTAACAAGCATCCAGG + Exonic
1099426440 12:82529549-82529571 GTTCATTTTAATACGTAGCAAGG + Intergenic
1099932862 12:89093463-89093485 CTGCATTTTAACAAGAACCCTGG + Intergenic
1100774488 12:97959317-97959339 CTGCATTTCAATAAGGCTCCAGG + Intergenic
1100822350 12:98443267-98443289 CTGCCTTTTAGTAAGCAGGCAGG - Intergenic
1101743960 12:107523702-107523724 CTACATTTTAATACGTACTCGGG + Intronic
1101747503 12:107554665-107554687 CTGCATTTTAAGAAGATCCCAGG - Intronic
1101749881 12:107574786-107574808 CTGCATTTTAACAAGATCCCAGG + Intronic
1101929630 12:109003071-109003093 CTGCATTTTAACCAGTCTCCAGG + Intronic
1102444031 12:112987582-112987604 CTGCATTTTAACAAGGTTCCAGG - Intronic
1102620279 12:114189136-114189158 CTGCATTTTAATAAGTACCTGGG - Intergenic
1102969429 12:117154623-117154645 CTGCAATTTAAAAATTAACCAGG - Intronic
1104558268 12:129821720-129821742 CTGCATTTTAAGAAGATCCCAGG - Intronic
1106524350 13:30527047-30527069 CCGCCTTTTAACAAGTAGCATGG + Intronic
1107675123 13:42788118-42788140 CTGCATTTTAATAAGGTACCTGG - Intronic
1107927939 13:45281573-45281595 CTGCATTTTAACAAGTGCCTAGG - Intronic
1108168853 13:47720697-47720719 CTGCATTTTAACAAGAGACCAGG - Intergenic
1109201760 13:59439458-59439480 CTACACTTTAAAAAGGAGCCCGG + Intergenic
1109560866 13:64048271-64048293 ATGCATTTTAATAAATAGTAAGG - Intergenic
1110807785 13:79777844-79777866 CTGGATTTTAAAAAGTAGAAAGG - Intergenic
1110930297 13:81207123-81207145 CCTCCTTTTAATAAGCAGCCAGG + Intergenic
1111025203 13:82511420-82511442 CTGCACTTACATAAATAGCCAGG - Intergenic
1111402871 13:87763888-87763910 CTGCATTTTAACAAGATCCCTGG - Intergenic
1112074864 13:95901536-95901558 CTGCATTTTAATAAGATACCAGG - Intronic
1112195216 13:97219148-97219170 CTGCATTTTAACAAGACCCCTGG + Intergenic
1113961114 13:114126613-114126635 CTACACTTTAATAAGTAGGAGGG - Intronic
1114434827 14:22697243-22697265 CTCTATTTTAATAAGAACCCTGG - Intergenic
1115414890 14:33120712-33120734 CTGCATTTTGACAAGATGCCCGG + Intronic
1116762933 14:49037427-49037449 CTGCATTTTAACAAATCCCCAGG + Intergenic
1118863706 14:69685549-69685571 CTGCATTTTACTAAGAGACCAGG - Intronic
1119001528 14:70886403-70886425 CTTCATTTTAACAAATCGCCTGG - Intergenic
1119044665 14:71308031-71308053 CTATATTTTAATAGGTACCCCGG + Intergenic
1125175950 15:36821957-36821979 ATGCATTTTAATCAGGAGCTTGG + Intergenic
1125182086 15:36888748-36888770 CAGCAATTTGATAAGGAGCCTGG - Intergenic
1126349238 15:47727458-47727480 CTGCATTTTAGCAAGATGCCAGG - Intronic
1126462917 15:48932344-48932366 CTGCATTTTAATAAGCAATCAGG + Intronic
1127856542 15:62958258-62958280 CTGCATTTTAACAAGATCCCAGG - Intergenic
1129789016 15:78328412-78328434 CTGCATTTTAACAAGCTCCCAGG + Intergenic
1130075821 15:80688974-80688996 ATAAATTTTAAAAAGTAGCCGGG - Intronic
1130792575 15:87171180-87171202 CTGCATTTAAATATTTAGGCTGG + Intergenic
1130805897 15:87321639-87321661 CTGTAATTTAATAAGGAGGCAGG + Intergenic
1130918089 15:88321728-88321750 CTGCATTTTAATAGGATCCCAGG - Intergenic
1131761355 15:95626373-95626395 CTGCATTTTAGTAAGACCCCAGG + Intergenic
1131995566 15:98129612-98129634 CTGCATTTTAATAGGCAGGTGGG + Intergenic
1132410398 15:101573656-101573678 CTGCATTTGAATAGCAAGCCTGG + Intergenic
1133041159 16:3060289-3060311 CTGCATTTTAACTAGTCGCGGGG + Exonic
1133146176 16:3788300-3788322 CTGCATTTTTATAAAAATCCTGG - Intronic
1133788405 16:8990556-8990578 CTGCATTTTAAAAACTCCCCAGG - Intergenic
1133862852 16:9612670-9612692 CTGCATTTTAACAAATTCCCAGG - Intergenic
1134208900 16:12259695-12259717 CTGCATTTTAATAACTATCCAGG - Intronic
1135115957 16:19723643-19723665 CTGCATTTTAACATGTATCCAGG - Intronic
1135904056 16:26494241-26494263 GTGCATTTTAATAAGAAAACAGG - Intergenic
1138238566 16:55407139-55407161 TTGCATTTTAGTAAGTTCCCAGG + Intronic
1138550921 16:57748023-57748045 CTGGATTTTAATAAGCTTCCAGG + Intronic
1139974532 16:70798679-70798701 CTGCATTTTAACAAGATCCCTGG - Intronic
1140271498 16:73470121-73470143 CTGCATTTTAATAACTTCCCAGG + Intergenic
1140594379 16:76391846-76391868 CTGCATTTTAATACGATCCCTGG + Intronic
1140818416 16:78641333-78641355 CTTCTTTTTAATTAGAAGCCTGG + Intronic
1140972871 16:80030149-80030171 TTGCATTTTAATAAGTTCCCGGG - Intergenic
1140997548 16:80276157-80276179 CTGCATTCTACTAAGGAGCTGGG - Intergenic
1140999799 16:80297645-80297667 CTGCATTTTAATAAAAACCCAGG + Intergenic
1141517716 16:84557456-84557478 CTGCATTTTCATAAATATACAGG + Intergenic
1142013455 16:87729822-87729844 CTGCATTTTAACAAGCTCCCAGG - Intronic
1142791670 17:2271416-2271438 ATACATTTTAAAAAGCAGCCAGG + Intronic
1144390594 17:14790067-14790089 CTGCATTTTAACAAGCAGCCCGG - Intergenic
1146420939 17:32685052-32685074 CTGCATTTTATCAAGTGACCAGG + Intronic
1148701853 17:49592310-49592332 CTGCATTTTAATAAGATCTCTGG - Intergenic
1151084130 17:71361577-71361599 CTTCATTTTCATAATTAGCATGG - Intergenic
1151091881 17:71449578-71449600 CCGCATTTTAATAAGTCCTCAGG + Intergenic
1151459396 17:74245719-74245741 CTGCATTTTAATAGGAAGCCGGG + Intronic
1152445685 17:80341575-80341597 CTGTACTTTAAAAATTAGCCAGG + Intronic
1203166604 17_GL000205v2_random:102825-102847 CTACATTTTAATAAATACACCGG - Intergenic
1152969970 18:152335-152357 CTGCATTTTAACAAGATCCCAGG + Intergenic
1153474142 18:5479107-5479129 CTGCAGTTTTATAACTAGCCTGG - Intronic
1154029043 18:10734414-10734436 CTGCATTTAAATAAGACCCCAGG + Intronic
1155008073 18:21747361-21747383 CTGCATTTTAAAAGGTCCCCAGG - Intronic
1156023267 18:32623334-32623356 TTGCATTTTAATAACTTCCCAGG - Intergenic
1156839349 18:41593185-41593207 CTGCATTTTCATAAATATCAAGG - Intergenic
1158623128 18:59049747-59049769 CTGCATTTTAACAAGCACCCTGG + Intergenic
1159876351 18:73815402-73815424 TAGCATTTTAATCAGTAGACTGG - Intergenic
1162845640 19:13390272-13390294 CAACATTTTAAGAATTAGCCAGG - Intronic
1162904607 19:13816286-13816308 CTAGATTTTAAAAATTAGCCAGG + Intronic
1164745243 19:30607422-30607444 TTATATTTTAAAAAGTAGCCGGG + Intronic
925259895 2:2520179-2520201 CTGCATTTTGATAAGATCCCAGG + Intergenic
925416607 2:3674458-3674480 CTGCACTTTTATAATTAGGCAGG - Intronic
926970045 2:18457638-18457660 CTGCATTTTAATAAGATCCCTGG - Intergenic
927169136 2:20353697-20353719 CTGCATTTTAACAAGATTCCCGG + Intergenic
929049276 2:37821345-37821367 CTGTATTTTAAATAGTACCCTGG - Intergenic
929318000 2:40504040-40504062 CTGCATTATAATTTGAAGCCAGG - Intronic
930228818 2:48822991-48823013 CTGCATTTTAACAAGATGCTGGG - Intergenic
930431497 2:51282463-51282485 CTATTTTTTAATAAGTAACCTGG + Intergenic
930656914 2:54015731-54015753 CTGCATTTTAACAAGATCCCAGG + Intronic
930788819 2:55301782-55301804 CTGCTTTTTAAAAAGTACACAGG + Intronic
932631396 2:73346287-73346309 TTGCATTTTAACAAGTTCCCAGG - Intergenic
933612005 2:84445958-84445980 CTGGAGTGTAATAAGTAGGCAGG - Intronic
933811368 2:86034780-86034802 CTTCATTTGAAAAAGTAGGCAGG + Intronic
934046153 2:88174101-88174123 CTGCATTTTAACAAGATCCCAGG + Intronic
935717047 2:105948390-105948412 CTGCATTTTAATCATTCCCCAGG - Intergenic
935848646 2:107195480-107195502 CTGCTTTTGAATAAGAAGCTTGG - Intergenic
937627969 2:124065134-124065156 CTACCTTTTAAAAAGCAGCCAGG + Intronic
938964855 2:136379376-136379398 GTGCATTTTAACAAGTTTCCAGG - Intergenic
939047978 2:137272120-137272142 TTGCATTATAAAAAATAGCCTGG + Intronic
939546643 2:143562927-143562949 TTGCTTTAAAATAAGTAGCCAGG - Intronic
940481617 2:154240473-154240495 CTGCATTTGAATAAATCTCCAGG + Intronic
940617522 2:156068257-156068279 CTACATTTTAATAAGAAGTGAGG + Intergenic
940648911 2:156421039-156421061 CTGCAGTTTAAGAAGTTTCCTGG - Intergenic
941357255 2:164509736-164509758 CTGCATTTTAACAAGATCCCAGG + Intronic
942708793 2:178808134-178808156 CTGCTCCTTAGTAAGTAGCCAGG + Intronic
943239990 2:185371030-185371052 CAGCATTTGAATCAGTAGACTGG + Intergenic
943706888 2:191045355-191045377 CTGCATTTTAACAAGAATCCTGG + Intronic
944635918 2:201676017-201676039 CTCCATTTTAATAAGAGCCCAGG + Intronic
944869322 2:203893987-203894009 CTGCATTTTAACAAGATCCCTGG + Intergenic
945046208 2:205784207-205784229 CTGCTCTTTAATAAGTTGCAGGG - Intronic
946535951 2:220628464-220628486 CTGCATTTTAAAAAGTCCCTGGG - Intergenic
947609944 2:231518506-231518528 CTTCAATTTAATGAGTAGGCTGG - Intergenic
948213776 2:236214228-236214250 CTGCATTTTCACAAGTCCCCAGG + Intronic
948259923 2:236596088-236596110 ATGCATTATAATAATTTGCCTGG - Intergenic
1169496474 20:6120759-6120781 CTGCATTTTAATAGGATCCCTGG - Intronic
1169724401 20:8713628-8713650 CTTCATTTTAATAAGACCCCAGG + Intronic
1169785402 20:9354471-9354493 CTGCATTTTAACAAGCCTCCAGG - Intronic
1169785815 20:9358203-9358225 TTGCATTTTAACAAGTTCCCAGG + Intronic
1170627999 20:18044140-18044162 CTGCATTTTAACAAGACCCCAGG - Intronic
1170693540 20:18636906-18636928 CTGCATTTTAGTAAGCACCATGG - Intronic
1170997921 20:21382653-21382675 CTGCAGTCTAATAAGTACCATGG + Intronic
1171233427 20:23505816-23505838 CTGCATTTTAATGAGATCCCAGG + Intergenic
1171720755 20:28560755-28560777 TTGCATTTTAATAAGCTTCCAGG + Intergenic
1171757291 20:29122563-29122585 TTGCATTTTAATAAGATTCCAGG - Intergenic
1171784869 20:29454112-29454134 TTGCATTTTAATAAGATCCCCGG - Intergenic
1171785016 20:29455909-29455931 TTGCATTTTAATAAGATCCCCGG + Intergenic
1171863311 20:30421450-30421472 TTGCATTTTAATAAGATTCCAGG - Intergenic
1172504806 20:35453976-35453998 CTGCATTTTAGAAAGTACCCAGG - Intronic
1172583671 20:36067160-36067182 TTGTATTTTAATAAGTTCCCAGG - Intergenic
1172618109 20:36303086-36303108 CTGCATTTTAACAAGACCCCTGG + Intergenic
1172902022 20:38342331-38342353 CTGCATTTTAACAAGCTCCCTGG - Intergenic
1173016074 20:39226897-39226919 CTGCATTTTAACAAGATCCCAGG - Intergenic
1173167499 20:40695828-40695850 TTGCATTTTAATAAGTTCTCTGG + Intergenic
1173176689 20:40770316-40770338 CTGCATTTAAATAAGATCCCTGG - Intergenic
1174207661 20:48852544-48852566 CTGCATTTTAAAAAGATGACCGG - Intergenic
1174380082 20:50150659-50150681 TGGCATTTTAGTAAATAGCCGGG - Intronic
1174501916 20:50991413-50991435 CTGCATTTCCATAAGAATCCAGG - Intergenic
1175189420 20:57201135-57201157 CTGCATTTTACCAAGATGCCTGG + Intronic
1175664013 20:60843077-60843099 CTGCATTTTAACAAGAGCCCAGG + Intergenic
1175852177 20:62099480-62099502 AGGCATTCTAATAAGTAGCCGGG - Intergenic
1176405149 21:6356272-6356294 CTACATTTTAATAAATATACCGG + Intergenic
1176432008 21:6632832-6632854 CTACATTTTAATAAATATACCGG - Intergenic
1178623281 21:34194771-34194793 CTGCATTTTAATGAGATCCCAGG + Intergenic
1180658102 22:17441528-17441550 CTTTCTTTTAAAAAGTAGCCGGG + Intronic
1182264722 22:29105254-29105276 CTGTATTTTAATAAGATCCCAGG - Intronic
1182322549 22:29487704-29487726 CTGCATTTTGATAAGATCCCCGG + Intronic
1183837599 22:40469038-40469060 CTACATTTTAATAAATTGCATGG + Intronic
950089350 3:10284480-10284502 CAGCCGTTTACTAAGTAGCCTGG + Intronic
950109495 3:10409964-10409986 CTGGATTTTAATAAGCACACAGG - Intronic
950236678 3:11327824-11327846 TTGCATTTTAATAAGAACCCAGG - Intronic
951094327 3:18610263-18610285 CTGCATTTTAACAAGATCCCAGG + Intergenic
951601201 3:24377729-24377751 CAGCTTTTTAACAAGGAGCCAGG - Intronic
951696801 3:25453549-25453571 CTGCATTTTAACAAGTTTCCAGG + Intronic
952327352 3:32333453-32333475 CTGCATTTTAACAAGACCCCTGG + Intronic
952734323 3:36673898-36673920 CTGCATTTTAACAAGATCCCGGG + Intergenic
953809142 3:46096997-46097019 CTGCATTTTAACAAGATCCCCGG + Intergenic
954806758 3:53225097-53225119 CTGCATTTTAACAAGTTGAGGGG + Intronic
956613066 3:71144083-71144105 CTGCTTTTTAAGAAGTAGTTTGG + Intronic
956764724 3:72474817-72474839 CTGCATTTTTACAAGCATCCTGG - Intergenic
956907370 3:73780863-73780885 CTCCATCTTAATTAGTAGCTGGG + Intergenic
957060389 3:75476558-75476580 CTGCATTTTAACAAGATGCCTGG + Intergenic
958900715 3:99883060-99883082 CTGCATTTTATGATGTAGACTGG - Intronic
960888300 3:122419089-122419111 AGGTATTTTAAAAAGTAGCCGGG - Intergenic
960993643 3:123327471-123327493 CTGCATCTTAAAAAGGACCCCGG - Intronic
961293003 3:125862852-125862874 CTGCATTTTAACAAGATGCCTGG - Intergenic
961576141 3:127837955-127837977 CTGCATTTTAACAAGGTTCCCGG + Intergenic
961922382 3:130441256-130441278 CTGCATTTTAACAAGATTCCTGG - Intronic
961998447 3:131270409-131270431 CTGCATTTTAACAAGATCCCTGG + Intronic
961999509 3:131280749-131280771 CTGTATTCCAATAAATAGCCGGG + Intronic
962291256 3:134138248-134138270 TTTCATTTTAATAAGTTCCCAGG - Intronic
963326040 3:143864336-143864358 CTGCATTTTAACAGGTTTCCAGG - Intergenic
963639694 3:147843411-147843433 CTGCATTTTCCTGAGTAGTCAGG - Intergenic
963852903 3:150225549-150225571 CTGCATTTTAACAAGATCCCAGG + Intergenic
964199925 3:154107812-154107834 CTGCATTTTATAAAGCAGCCAGG - Intergenic
964869079 3:161293352-161293374 CTGCAGTGTACTTAGTAGCCTGG + Intergenic
965641495 3:170833521-170833543 CTGCATTTTAGTAAGTTCCCAGG - Intronic
967625212 3:191674561-191674583 CTGCTTCTTAATATGTACCCAGG - Intergenic
968880908 4:3299580-3299602 CGGCACTTTGATTAGTAGCCAGG + Intronic
971013686 4:22465713-22465735 GTTGATTTTAATAAGTGGCCAGG + Intronic
971099003 4:23441647-23441669 CTGAATTTAAATCTGTAGCCTGG + Intergenic
972060425 4:34864132-34864154 CTACATTTTAATATATAGGCTGG - Intergenic
972262722 4:37426766-37426788 CTACATTTTAGCAAGTACCCTGG + Intronic
972982071 4:44716727-44716749 CTGTAATTTGATAAGTAGGCTGG + Intronic
973074962 4:45912632-45912654 CTGCATTTTTATAAAGAGACTGG - Intergenic
973117156 4:46476029-46476051 CTGCATTTTAAAATGTTACCTGG + Intergenic
973555693 4:52080360-52080382 CTGCAATTTAACAAGCACCCAGG + Intronic
975890138 4:79017727-79017749 CTTCATTTTTATAAGTCACCAGG - Intergenic
976302235 4:83526117-83526139 CTAAATTTTAAAAATTAGCCAGG - Intergenic
977172161 4:93776554-93776576 CTGCATGTTGATATGGAGCCAGG - Intergenic
977701338 4:100026412-100026434 CTTCATTTTAATAAGTTCCTGGG + Intergenic
978196020 4:105973009-105973031 CTGCATTTTAACAAGATTCCAGG - Intronic
978713267 4:111810711-111810733 TTGCATTCTAACAAGTTGCCTGG + Intergenic
979230946 4:118348561-118348583 CTGCATTTTAACAAGTCCCAAGG + Intronic
980860553 4:138494826-138494848 CTGTATTTTAATAAGATCCCTGG - Intergenic
981122809 4:141072005-141072027 CTGCATTTTAACAAGTTTCCAGG - Intronic
981706076 4:147660331-147660353 CTGTATTTAAATAAGCAGGCTGG + Intronic
983208963 4:164939360-164939382 CTTCTCTTCAATAAGTAGCCTGG + Intergenic
984483732 4:180338572-180338594 CTGCATTTTAACAAGCACCCTGG + Intergenic
984874912 4:184358813-184358835 CAGCATTTGACTAGGTAGCCTGG + Intergenic
986864281 5:11967004-11967026 CTGCATTTTATTTAGTTTCCAGG + Intergenic
988696736 5:33628983-33629005 AGGCATTCTAATAAGTAGCCAGG - Intronic
989098388 5:37802038-37802060 CTGCATTTTAACAAGTTCCCTGG + Intergenic
989512452 5:42303985-42304007 TAGCATTTTAATCAGTATCCAGG + Intergenic
989666606 5:43861278-43861300 ATGCATTTTAAAAAGAAGCTGGG + Intergenic
989801805 5:45551213-45551235 CTTCATTGTAATACCTAGCCAGG - Intronic
990241187 5:53818234-53818256 CTGCATTTTAACAAGATCCCAGG + Intergenic
990934704 5:61135635-61135657 CTGTGTTTTAATAAGTTTCCAGG + Intronic
993107732 5:83618504-83618526 TTATATTTTAATAAGTAGCATGG + Intergenic
994934708 5:106239213-106239235 CTGCAATTTAATTAATGGCCAGG + Intergenic
995050478 5:107697497-107697519 CTACAATTTAGTTAGTAGCCTGG + Intergenic
995625067 5:114067309-114067331 CTGCATTTTATCAGGTTGCCAGG - Intergenic
996794894 5:127334396-127334418 CTGCATTTTAACAAGATCCCAGG + Intronic
996855081 5:127996722-127996744 CTGGATTATACTAAGTAGACTGG + Intergenic
996945896 5:129067157-129067179 CTGCATTTTAACAAGTTCCTAGG - Intergenic
997082876 5:130761585-130761607 CTGCATTTTAACAAGTTTTCAGG - Intergenic
998544192 5:143012186-143012208 CTGACCTTTAATAAGTGGCCTGG + Intronic
999266811 5:150271842-150271864 CTGCATTTTAACAAGACACCGGG - Intronic
999267211 5:150274653-150274675 CTGCATTTTAACAAGGTGCCTGG - Intronic
999629195 5:153552702-153552724 CTGCATTTTAACAAATCTCCAGG - Intronic
999831346 5:155323061-155323083 CTACATTTTAATGAAAAGCCTGG - Intergenic
1000980729 5:167813854-167813876 CTGCATTGTAATATGTAGGATGG - Intronic
1001233210 5:170007825-170007847 CTGCAGGTTAATAAGCAGTCAGG - Intronic
1001635286 5:173205775-173205797 CTTCATTTTCTTTAGTAGCCTGG + Intergenic
1001917058 5:175570569-175570591 CTGCATTTGAATAAGTAAGTGGG + Intergenic
1003533245 6:6955057-6955079 CTGCATTTTAACAAGGTCCCAGG + Intergenic
1003693351 6:8376843-8376865 CTGCATTTGAATAAGATCCCCGG + Intergenic
1004645418 6:17555503-17555525 CTGCATTTTAATAAGATCCTGGG + Intronic
1004707051 6:18134351-18134373 CTGCAATTTAACAAATATCCTGG + Intronic
1005015906 6:21375392-21375414 TTGCATTTTAAAAAGTACCCAGG + Intergenic
1005957187 6:30672383-30672405 CTGCATTTTAACAAGAACCTTGG + Intronic
1006406217 6:33847247-33847269 CTGCATTTTAATAAGTTCCCTGG + Intergenic
1006719416 6:36140487-36140509 CTGCATTTTAACAAGTCCCCTGG - Intronic
1006844861 6:37055187-37055209 CTGGCATTTAGTAAGTAGCCAGG + Intergenic
1008014686 6:46505079-46505101 CTGCATTCTAACAAGTTCCCGGG - Intergenic
1008311335 6:49978341-49978363 CTGCATTTTAACAAGAACCCAGG - Intergenic
1011354685 6:86461862-86461884 CTGCATTTTAACAAGTGCCTAGG - Intergenic
1012377116 6:98575332-98575354 CTGCAATTTACTACGTAACCAGG + Intergenic
1014085683 6:117340342-117340364 CTGCATTTTAAGAAGTAGTGAGG + Intronic
1014092096 6:117415649-117415671 TTTCATTTTATTATGTAGCCTGG - Intronic
1016804725 6:148201522-148201544 TTGCATTTTTCTAAGTTGCCAGG + Intergenic
1018717276 6:166543331-166543353 CTGCATTTTAACAAGTTCCTTGG - Intronic
1019817882 7:3214510-3214532 CAACATTTTAAAAAGTAGCTAGG + Intergenic
1019819953 7:3235008-3235030 TTGCGTTTTAATAAGATGCCCGG + Intergenic
1020717936 7:11701626-11701648 CTGCATTTTAACAAGACCCCAGG - Intronic
1020810821 7:12847717-12847739 CAGCAATTTAATAAGTATCTAGG + Intergenic
1021297200 7:18922574-18922596 CTGCATTTTAACAAACACCCAGG + Intronic
1021648534 7:22810146-22810168 GTGCATTTTAACAAGTTTCCAGG + Intergenic
1021847976 7:24780939-24780961 CTGCATTTTAACATGTACCCAGG + Intergenic
1022273918 7:28837983-28838005 CTGCATTTTAATAAGAACCCAGG + Intergenic
1023106418 7:36767268-36767290 CTGTATTTTAGTTAGTACCCTGG - Intergenic
1023594129 7:41810867-41810889 CTGCACTTTAACAAGTTCCCAGG + Intergenic
1023630540 7:42159549-42159571 GTGCATTTTAAGAAGTAGTCTGG - Intronic
1026952760 7:74358511-74358533 TTGCAGTATAATAAGTAGCCGGG - Intronic
1028135913 7:87222677-87222699 CTACTTTTTAATAAATACCCGGG + Intergenic
1028512601 7:91641685-91641707 CTGCATTTTAATAAGATATCTGG + Intergenic
1029616775 7:101664329-101664351 ATGCAAATTAATGAGTAGCCTGG - Intergenic
1030098916 7:105927104-105927126 CTCCATTTTAATGTGCAGCCAGG - Intronic
1030377713 7:108772769-108772791 CTGCATTTTAGTAAGCACTCAGG + Intergenic
1031713030 7:125073063-125073085 GTGCATTTTTATAAGTTCCCAGG - Intergenic
1031958575 7:127967955-127967977 CAGCATTGTAATAAGCATCCAGG - Intronic
1032933529 7:136702016-136702038 ATCCATATTAATGAGTAGCCTGG + Intergenic
1034163792 7:149010843-149010865 CTGCATTTTAACAAATTCCCTGG + Intronic
1035094147 7:156340029-156340051 TTGCATTCTAATAAGGACCCAGG - Intergenic
1035706728 8:1681495-1681517 TAACATTTTAAAAAGTAGCCCGG + Intronic
1037156804 8:15710622-15710644 CTGCATTTTAATAAGTAGCCTGG - Intronic
1039371949 8:36994003-36994025 TTGCATTTTAGTAAGTTTCCAGG + Intergenic
1039514087 8:38116817-38116839 AAGCATTTTAGTAAGTATCCAGG - Intronic
1041502663 8:58555509-58555531 CTTCTTTTTAATAAGTATCCTGG - Intronic
1041568401 8:59307251-59307273 CTGCCTTGTAATATGTAGACGGG - Intergenic
1041919128 8:63163418-63163440 CTGCATTTGAATAAGTTCCTAGG + Intergenic
1042278307 8:67028385-67028407 CTGCATTTTAACAAATGTCCCGG + Intronic
1043516901 8:81003062-81003084 CTGCATTTCAACAAGTTCCCAGG - Intronic
1043668057 8:82843566-82843588 CTACATTCTAATAAGTGGTCAGG + Intergenic
1044659646 8:94582502-94582524 AAGCATTTTAAAAATTAGCCAGG - Intergenic
1044904221 8:96982497-96982519 AAGAATTTTAATAATTAGCCGGG - Intronic
1045327431 8:101127248-101127270 CTGCATTTTAACAAGATCCCAGG - Intergenic
1045984112 8:108227955-108227977 CTGCATTTTAATAAGATCCCAGG - Intronic
1046277032 8:111975458-111975480 CTCCATTTTAACAAGTTCCCTGG - Intergenic
1046434577 8:114170472-114170494 CTGCACTTATATAAGTAACCAGG - Intergenic
1047000388 8:120567281-120567303 CTGAATCTTAATAAACAGCCAGG + Intronic
1048712639 8:137229013-137229035 ATTCATTTTAATAAGTACCCAGG + Intergenic
1050463350 9:5895639-5895661 CTGCATTTTAACAAGTTCCATGG - Intronic
1050950284 9:11582450-11582472 CTTCATTTTAATACTCAGCCAGG - Intergenic
1051348050 9:16170598-16170620 CTGCCTTATAATAAGAAGACTGG + Intergenic
1052083878 9:24239940-24239962 CTGCATTTTAATAAGTGTTGCGG - Intergenic
1052330659 9:27264519-27264541 CTGCATTTTAACAAGAGTCCCGG + Intergenic
1052373162 9:27688826-27688848 CTGCATTTTAATGAGATCCCTGG + Intergenic
1052798955 9:32949767-32949789 CTGCTTTTTAAAAAATAGTCAGG + Intergenic
1053267276 9:36724439-36724461 CTGCATTGTAATAAGAGCCCTGG + Intergenic
1053402509 9:37838593-37838615 ATTCATTTTAAAAAGAAGCCGGG + Intronic
1055550563 9:77428670-77428692 CTGCATTTTAACAAGAACCCAGG - Intronic
1055775086 9:79759241-79759263 GTGCATTTTAAAAATTAGGCAGG + Intergenic
1056972481 9:91218477-91218499 CTGCATTTTAACAAGGAGGATGG - Intronic
1057596727 9:96420875-96420897 CTCCATTTTAAAAAGGAGCTGGG + Intergenic
1057645633 9:96872635-96872657 AAGCATTTTTATAAGTTGCCTGG + Intronic
1057889743 9:98860509-98860531 CTGCCTTTTAACAAGATGCCAGG - Intergenic
1057908472 9:99000145-99000167 TTGCAATTTAAAAAGCAGCCCGG - Intronic
1058726755 9:107812049-107812071 CTGCATTTTAACAAGATCCCTGG + Intergenic
1059402779 9:114081109-114081131 CTGCTTTTTAAAAATTAACCTGG + Intergenic
1060011569 9:120047835-120047857 CTTTATTTTAATAAGTAGAAGGG + Intergenic
1060441274 9:123641891-123641913 CTGCATTTTAACAAGTTTTCTGG + Intronic
1061025671 9:128047763-128047785 CTGCATTTTAAAGAGTTTCCAGG + Intergenic
1202801151 9_KI270720v1_random:257-279 TTGCATTTTAATAAGATTCCAGG + Intergenic
1203445809 Un_GL000219v1:55064-55086 TTGCATTTTAATAAGATCCCCGG + Intergenic
1186597759 X:11002448-11002470 CTGCATTTTAAAAAGCAGTTAGG + Intergenic
1186671831 X:11775064-11775086 CAACATTTTAATAAATTGCCCGG - Exonic
1186887062 X:13924457-13924479 CTAAATTTTAAAAATTAGCCTGG - Intronic
1187168014 X:16822868-16822890 CTGCATTTTAACAAATGCCCGGG + Intronic
1187406368 X:19008268-19008290 CTGCGTTTTAATTATTAGGCTGG - Intronic
1187426788 X:19184749-19184771 CTGCATTTTAACAAGATGTCTGG - Intergenic
1187744787 X:22397111-22397133 CTGTATTTTAATAAGTTCCCAGG + Intergenic
1188788386 X:34377551-34377573 CTTCATTTTAACAAGTTCCCTGG + Intergenic
1189012514 X:37060670-37060692 CTGCATTCTAATATGCAGCAAGG + Intergenic
1190963548 X:55276455-55276477 CTGCATTTTAAATAGGAGCTGGG + Intronic
1190999954 X:55649134-55649156 ATGCATTTTAAAAGGTAGCTTGG + Intergenic
1192072134 X:67952283-67952305 CTGCATTATAATGAGTATCTTGG - Intergenic
1192748961 X:73968263-73968285 AGCCATTTTAATAAGGAGCCCGG + Intergenic
1194347632 X:92785597-92785619 CAGCATTTTAAGAATTAGCCTGG - Intergenic
1195375343 X:104221316-104221338 ATGCATTTTAATAAGCTCCCAGG + Intergenic
1195459816 X:105111689-105111711 AGGCATTTTAATGAGTACCCTGG + Intronic
1198030649 X:132750690-132750712 CTGCAATTTAACAAATACCCAGG + Intronic
1199654450 X:149980815-149980837 CTGGATTTTAATAAGATGCTAGG + Intergenic
1200370159 X:155716611-155716633 TTGTATTTTAATAATTTGCCTGG + Intergenic
1200655958 Y:5902230-5902252 CAGCATTTTAAGAATTAGCCTGG - Intergenic
1201965699 Y:19732276-19732298 CTGCATTTTCATATGTTTCCAGG + Intronic