ID: 1037165567

View in Genome Browser
Species Human (GRCh38)
Location 8:15824384-15824406
Sequence ATATATACAAACTTGGTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037165563_1037165567 13 Left 1037165563 8:15824348-15824370 CCATTGGCAAGGTATGAATATCA No data
Right 1037165567 8:15824384-15824406 ATATATACAAACTTGGTGCTAGG No data
1037165560_1037165567 29 Left 1037165560 8:15824332-15824354 CCTAAAACAGGCAACTCCATTGG No data
Right 1037165567 8:15824384-15824406 ATATATACAAACTTGGTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037165567 Original CRISPR ATATATACAAACTTGGTGCT AGG Intergenic
No off target data available for this crispr