ID: 1037167629

View in Genome Browser
Species Human (GRCh38)
Location 8:15849879-15849901
Sequence CCACTTTGAGAGTGATGCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037167629_1037167633 -1 Left 1037167629 8:15849879-15849901 CCGGAGCATCACTCTCAAAGTGG No data
Right 1037167633 8:15849901-15849923 GCGAAGGAAAATAAAGACAAGGG No data
1037167629_1037167632 -2 Left 1037167629 8:15849879-15849901 CCGGAGCATCACTCTCAAAGTGG No data
Right 1037167632 8:15849900-15849922 GGCGAAGGAAAATAAAGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037167629 Original CRISPR CCACTTTGAGAGTGATGCTC CGG (reversed) Intergenic
No off target data available for this crispr