ID: 1037179802

View in Genome Browser
Species Human (GRCh38)
Location 8:15992191-15992213
Sequence CTGCCAGGAGGCTAGACTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037179802_1037179809 17 Left 1037179802 8:15992191-15992213 CCAGTAGTCTAGCCTCCTGGCAG No data
Right 1037179809 8:15992231-15992253 CAGTGGTAGCAGGTCCAAGATGG No data
1037179802_1037179804 -10 Left 1037179802 8:15992191-15992213 CCAGTAGTCTAGCCTCCTGGCAG No data
Right 1037179804 8:15992204-15992226 CTCCTGGCAGCACACATAGATGG No data
1037179802_1037179806 0 Left 1037179802 8:15992191-15992213 CCAGTAGTCTAGCCTCCTGGCAG No data
Right 1037179806 8:15992214-15992236 CACACATAGATGGACACCAGTGG No data
1037179802_1037179811 28 Left 1037179802 8:15992191-15992213 CCAGTAGTCTAGCCTCCTGGCAG No data
Right 1037179811 8:15992242-15992264 GGTCCAAGATGGCCAACTTTGGG No data
1037179802_1037179812 29 Left 1037179802 8:15992191-15992213 CCAGTAGTCTAGCCTCCTGGCAG No data
Right 1037179812 8:15992243-15992265 GTCCAAGATGGCCAACTTTGGGG No data
1037179802_1037179810 27 Left 1037179802 8:15992191-15992213 CCAGTAGTCTAGCCTCCTGGCAG No data
Right 1037179810 8:15992241-15992263 AGGTCCAAGATGGCCAACTTTGG No data
1037179802_1037179807 7 Left 1037179802 8:15992191-15992213 CCAGTAGTCTAGCCTCCTGGCAG No data
Right 1037179807 8:15992221-15992243 AGATGGACACCAGTGGTAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037179802 Original CRISPR CTGCCAGGAGGCTAGACTAC TGG (reversed) Intergenic
No off target data available for this crispr