ID: 1037179805

View in Genome Browser
Species Human (GRCh38)
Location 8:15992206-15992228
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037179805_1037179815 23 Left 1037179805 8:15992206-15992228 CCTGGCAGCACACATAGATGGAC No data
Right 1037179815 8:15992252-15992274 GGCCAACTTTGGGGACTTCAGGG No data
1037179805_1037179814 22 Left 1037179805 8:15992206-15992228 CCTGGCAGCACACATAGATGGAC No data
Right 1037179814 8:15992251-15992273 TGGCCAACTTTGGGGACTTCAGG No data
1037179805_1037179811 13 Left 1037179805 8:15992206-15992228 CCTGGCAGCACACATAGATGGAC No data
Right 1037179811 8:15992242-15992264 GGTCCAAGATGGCCAACTTTGGG No data
1037179805_1037179809 2 Left 1037179805 8:15992206-15992228 CCTGGCAGCACACATAGATGGAC No data
Right 1037179809 8:15992231-15992253 CAGTGGTAGCAGGTCCAAGATGG No data
1037179805_1037179810 12 Left 1037179805 8:15992206-15992228 CCTGGCAGCACACATAGATGGAC No data
Right 1037179810 8:15992241-15992263 AGGTCCAAGATGGCCAACTTTGG No data
1037179805_1037179812 14 Left 1037179805 8:15992206-15992228 CCTGGCAGCACACATAGATGGAC No data
Right 1037179812 8:15992243-15992265 GTCCAAGATGGCCAACTTTGGGG No data
1037179805_1037179807 -8 Left 1037179805 8:15992206-15992228 CCTGGCAGCACACATAGATGGAC No data
Right 1037179807 8:15992221-15992243 AGATGGACACCAGTGGTAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037179805 Original CRISPR GTCCATCTATGTGTGCTGCC AGG (reversed) Intergenic
No off target data available for this crispr