ID: 1037179807

View in Genome Browser
Species Human (GRCh38)
Location 8:15992221-15992243
Sequence AGATGGACACCAGTGGTAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037179803_1037179807 -5 Left 1037179803 8:15992203-15992225 CCTCCTGGCAGCACACATAGATG No data
Right 1037179807 8:15992221-15992243 AGATGGACACCAGTGGTAGCAGG No data
1037179802_1037179807 7 Left 1037179802 8:15992191-15992213 CCAGTAGTCTAGCCTCCTGGCAG No data
Right 1037179807 8:15992221-15992243 AGATGGACACCAGTGGTAGCAGG No data
1037179805_1037179807 -8 Left 1037179805 8:15992206-15992228 CCTGGCAGCACACATAGATGGAC No data
Right 1037179807 8:15992221-15992243 AGATGGACACCAGTGGTAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037179807 Original CRISPR AGATGGACACCAGTGGTAGC AGG Intergenic
No off target data available for this crispr