ID: 1037192430

View in Genome Browser
Species Human (GRCh38)
Location 8:16142824-16142846
Sequence CTGGGAATACAGAGGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037192423_1037192430 20 Left 1037192423 8:16142781-16142803 CCATGGACACACAGACACACACA 0: 2
1: 18
2: 380
3: 2954
4: 12310
Right 1037192430 8:16142824-16142846 CTGGGAATACAGAGGGAGGGAGG No data
1037192421_1037192430 26 Left 1037192421 8:16142775-16142797 CCTATCCCATGGACACACAGACA 0: 1
1: 1
2: 3
3: 40
4: 433
Right 1037192430 8:16142824-16142846 CTGGGAATACAGAGGGAGGGAGG No data
1037192422_1037192430 21 Left 1037192422 8:16142780-16142802 CCCATGGACACACAGACACACAC 0: 2
1: 8
2: 156
3: 1160
4: 7405
Right 1037192430 8:16142824-16142846 CTGGGAATACAGAGGGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037192430 Original CRISPR CTGGGAATACAGAGGGAGGG AGG Intronic
No off target data available for this crispr