ID: 1037193166

View in Genome Browser
Species Human (GRCh38)
Location 8:16152359-16152381
Sequence CCTGGCCCGCCCCTTCCCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 247}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037193166_1037193169 -7 Left 1037193166 8:16152359-16152381 CCTATGGGAAGGGGCGGGCCAGG 0: 1
1: 0
2: 1
3: 20
4: 247
Right 1037193169 8:16152375-16152397 GGCCAGGGTAAAGATATACGTGG No data
1037193166_1037193171 16 Left 1037193166 8:16152359-16152381 CCTATGGGAAGGGGCGGGCCAGG 0: 1
1: 0
2: 1
3: 20
4: 247
Right 1037193171 8:16152398-16152420 ATATAAACATTAATAAAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037193166 Original CRISPR CCTGGCCCGCCCCTTCCCAT AGG (reversed) Intronic
900114823 1:1023992-1024014 CCTGGCCAGCCCCACCCCAGGGG - Intronic
900173297 1:1281042-1281064 CCTGGCCTGCCCATGCCCACGGG + Intronic
900237296 1:1598885-1598907 CCTGCCCCGCCCCACCCCACTGG - Exonic
900420079 1:2552501-2552523 CCTGGCACGCTTCTTCCCCTCGG + Intergenic
900536195 1:3178965-3178987 CCTTGCCCAGCCCTTCCCTTGGG + Intronic
900737592 1:4308904-4308926 CCTGCCCTCTCCCTTCCCATAGG + Intergenic
901644520 1:10709335-10709357 CCTGGCCAGCCCTTTCACAGGGG + Intronic
901660589 1:10795949-10795971 CCCCACCCACCCCTTCCCATGGG + Intronic
902383755 1:16064977-16064999 CCTGGCTCACCCCTGCCCGTTGG + Intronic
903035711 1:20491380-20491402 CCTGCCCGGCCCCATGCCATTGG - Intergenic
903044313 1:20553933-20553955 CCTGGCCCGCCCGCTCCCTGGGG - Exonic
903684382 1:25120187-25120209 CCTGGCCAGCCCATTGCCCTGGG + Intergenic
904753464 1:32755052-32755074 CCTTTCCCTCCCCTCCCCATTGG - Intronic
905210449 1:36370343-36370365 CCTGGCCTGTCCCTTCACACTGG + Intronic
907322931 1:53616996-53617018 CCTGACCAGCCCCACCCCATGGG + Intronic
908768217 1:67572855-67572877 CCTGGCCCGGCCCTTCTCAGAGG + Intergenic
915121903 1:153634483-153634505 CCTCCCCCGCCCCTTCGCAGGGG - Intronic
916821022 1:168398935-168398957 CCTGGCCCATCACTACCCATAGG + Intergenic
919813105 1:201421303-201421325 CCAGGGCCACCCCTTCCCCTGGG + Intronic
920074352 1:203325775-203325797 CCTGTCCTCCCCCTTCCCAAGGG - Intergenic
920380726 1:205533185-205533207 CCTGGCCAGCCCCACCCCACAGG - Intergenic
921316270 1:213894246-213894268 CCTGGCCCAGCCTTCCCCATGGG + Intergenic
922749422 1:228063642-228063664 CCTGGTCAGCCCCAGCCCATGGG + Intergenic
923279581 1:232430258-232430280 CCTGGCCAGCACCCTCCCAAAGG - Intronic
1066298094 10:34073438-34073460 CCTAGCCCCCCACTTCCCACAGG - Intergenic
1067723751 10:48750539-48750561 CCTGCCCATCCCCATCCCATGGG + Intronic
1069747878 10:70727267-70727289 CCTGGCTCACCCCTTGCCATGGG + Intronic
1070837457 10:79458810-79458832 CTTGGCCAGCCTCTTGCCATTGG + Intergenic
1071288052 10:84166978-84167000 CATGGCCTGCCCCTACCCACAGG + Intergenic
1071298813 10:84241478-84241500 CCTGGACCGCTCCGTCCCACCGG + Intergenic
1072050790 10:91701040-91701062 CCTGGCCCCTCGCTTCCCAAGGG + Intergenic
1073290128 10:102409306-102409328 CCTCGCCCTCCCTTTCCCGTCGG - Intronic
1075318186 10:121468690-121468712 CCTGGCCTGCCACTTCCAAAAGG - Intergenic
1077192308 11:1260542-1260564 GCTGGGCCGACCCTCCCCATGGG - Intronic
1078813137 11:14791772-14791794 CAGGCCCCTCCCCTTCCCATGGG + Intronic
1081867605 11:46368097-46368119 CTTTGCCCGCCCCTGCCCTTTGG + Intronic
1081876988 11:46415103-46415125 CCTGGCACACCCATTCCCAAGGG - Intronic
1083203056 11:61131859-61131881 CCGGGCCCGCCCCTCCCTATGGG - Exonic
1083814988 11:65127740-65127762 CCTGCCCCGCCCCTCCCCCCAGG - Exonic
1083886870 11:65577264-65577286 CCTGCCCCAGCCCTTCCCCTGGG - Intronic
1084148917 11:67279054-67279076 CCTGGCCCACCCCTTGCCTGGGG + Intronic
1084582486 11:70032571-70032593 CCTTGCCCACCCCTTCACAGTGG - Intergenic
1085132955 11:74057625-74057647 CCTGGCCCTCTTCTTCCTATGGG + Intronic
1085511985 11:77093169-77093191 CCTGGCCCACCGCTCCCCACTGG + Intronic
1086990972 11:93303647-93303669 GGTGGCCCACCCCTTCCCCTGGG - Intergenic
1090837292 11:130462678-130462700 CCAGACCCGCCACTTCCCCTGGG + Exonic
1090868517 11:130723061-130723083 CCTCGCCCATCCCTGCCCATGGG + Intergenic
1091233208 11:134001700-134001722 CCTGGCTGGCCCCTTCTCGTGGG + Intergenic
1092102863 12:5900696-5900718 CCTGTCCCGGCCCCACCCATGGG - Intronic
1094707379 12:32927366-32927388 CCAAGCCCACCCCTTCCCACCGG - Intergenic
1095739752 12:45593792-45593814 CCTGCCCAGCCCCTTCCCTTGGG + Intergenic
1099225585 12:79965023-79965045 TATGGCCTGCCCCTTCACATTGG + Intergenic
1099365287 12:81759574-81759596 CCTGGCCCTCGCCTTCGCAGGGG - Intergenic
1100115132 12:91294729-91294751 CCTTGGCTGCCCCTTCCCTTAGG - Intergenic
1101910551 12:108857617-108857639 CCGGGCCCGCCCCTCCCCCTCGG + Intergenic
1102950083 12:117025640-117025662 CCTGGCCCGCCCCCTCGCTGTGG + Intronic
1103835131 12:123812924-123812946 CCATGTCCGCCCCTTTCCATTGG + Intronic
1104623866 12:130337702-130337724 CCAGGCCCGCCCCGCCCCACAGG - Intergenic
1104925530 12:132312325-132312347 CCTGGCCCTCTGCTTCCCTTTGG + Intronic
1113311457 13:109137224-109137246 CCTGGCCCCCTCCTTCCCTTGGG - Intronic
1113615983 13:111681044-111681066 GCTGGCCAGCCCCTGCCCAGTGG + Intergenic
1113621451 13:111765937-111765959 GCTGGCCAGCCCCTGCCCAGTGG + Intergenic
1113801212 13:113087311-113087333 CCTGGCCAGCTCCTTCACCTTGG - Exonic
1116859150 14:49979698-49979720 CCTGGCCAGCCCATTTGCATGGG + Intergenic
1118329516 14:64804629-64804651 CCTGGCCCTCATCTCCCCATCGG - Intronic
1119231698 14:72985001-72985023 CCTGGCCCTGCCCTTGCCCTAGG + Intronic
1120859342 14:89240866-89240888 CCAGGCCCGGCCCTACCCCTGGG - Intronic
1121341917 14:93110522-93110544 CCGGGCCTGTCCCTTCCCCTTGG - Intronic
1122604922 14:102941809-102941831 CCTGCCCCTCCCCATCCCTTAGG - Intronic
1124925207 15:34063923-34063945 CATGCCCTGCCCCTTCCCAGTGG + Exonic
1125475797 15:40047400-40047422 CCAGGCCCTTCCCTTCCCAAGGG - Intergenic
1127899078 15:63327968-63327990 CCTGGCCCTCTCCTTGCTATGGG - Intronic
1128454979 15:67827169-67827191 CCGGGCCCGCCCCTGCCCCCGGG - Intronic
1131517598 15:93089291-93089313 CCCGGCCCGCCCCCTCCCCTCGG - Intergenic
1132227029 15:100150713-100150735 CCTGGCCCGCCACATCTCACTGG + Intronic
1132573744 16:655519-655541 CCTGGGCCTCCCCTTCCCTGAGG + Intronic
1133465781 16:6025666-6025688 CCTGGCCCACACCTACCAATGGG - Intronic
1136999239 16:35215003-35215025 CCTTGCTGGCCCCTGCCCATGGG + Intergenic
1142433426 16:90042784-90042806 CCTGGTCAGCCCCTTCCCCTGGG + Intronic
1143107521 17:4536979-4537001 CCTGGCCTTCCCCTTTCCTTAGG - Intronic
1143610417 17:8014772-8014794 CCCAGCCCACCCCTTCCCACTGG - Intronic
1143921896 17:10336782-10336804 CCTCGCCTGCTCCATCCCATGGG + Intronic
1144343562 17:14331026-14331048 TCTGTCCCGCCCCTGCCCATTGG + Intronic
1144497390 17:15757228-15757250 CCTTGACCGCCCCTCCCCACCGG + Intergenic
1144629182 17:16861712-16861734 CCTTGACCGCCCCTCCCCACCGG + Intergenic
1145160752 17:20572277-20572299 CCTTGACCGCCCCTCCCCACCGG + Intergenic
1147133488 17:38422097-38422119 CCTGGCCTGACCCCTCCCAGAGG + Intergenic
1147428455 17:40357233-40357255 CCTGGCCAGCCCCTTCACAGTGG - Intronic
1148050587 17:44768186-44768208 CCTGGCCTTCCCCTGCCCCTGGG - Intronic
1148130757 17:45261477-45261499 CCTGTGTCTCCCCTTCCCATAGG - Intronic
1148747909 17:49928569-49928591 CCTAGCCTGCCCCTTTCCCTCGG - Intergenic
1148858902 17:50593834-50593856 ACTGGCCCAGCCCCTCCCATGGG - Intronic
1150258971 17:63773395-63773417 CCTGGCCCGCTCCTTACCTGTGG + Exonic
1151301816 17:73232382-73232404 CCGAGCCCGCCTCTTCCCGTGGG - Intronic
1151757411 17:76082698-76082720 CATGGCCCGCCCCCAGCCATGGG - Exonic
1152014006 17:77737589-77737611 CCTCGCCTGTTCCTTCCCATGGG - Intergenic
1152065138 17:78108247-78108269 GCTGGCCCCCCCCCACCCATGGG + Exonic
1156134900 18:34025939-34025961 CCTGGCTCACCCATTACCATAGG - Intronic
1157009796 18:43633443-43633465 CCTTGCCCCCCCCCGCCCATAGG + Intergenic
1157596653 18:48868180-48868202 CCTGGCCCAGGCCTTCCAATGGG + Intergenic
1159948005 18:74457866-74457888 CCCAGCCCTCCCCTTCCCACGGG + Intronic
1160855886 19:1217653-1217675 CTTCGCCTGCCCCTTCCTATGGG + Intronic
1160869240 19:1269498-1269520 CCGGGCCCGCCCCCTCCCAGGGG - Intronic
1161778785 19:6278396-6278418 TCTGGACGGCCCCTCCCCATTGG - Intronic
1162510798 19:11116965-11116987 GCTGGCCCACCCCTTCTCCTTGG + Exonic
1163311015 19:16514677-16514699 ACTGCCCTGCCCCTGCCCATGGG - Intronic
1163390491 19:17027201-17027223 CCGGGCCCGCCCCTCACCAGGGG + Intergenic
1164782718 19:30906519-30906541 CCTTACCCTCCCCTCCCCATAGG - Intergenic
1165311002 19:35029719-35029741 CCTGCCCCGCCCCTCTCCGTGGG - Intergenic
1165798743 19:38534877-38534899 CCTGGCTCGCCCATTCCCTGTGG + Intronic
1166342357 19:42146314-42146336 CCTTGCCCACCCTGTCCCATTGG + Intronic
1166705461 19:44905734-44905756 CCTGTCCCGCCCCCTCCCCCAGG - Exonic
1166981957 19:46636215-46636237 CCCGCCCCGCCCCCTCCCCTGGG + Intergenic
1167441844 19:49513329-49513351 CCCGGCCCGCCCCTTCCTCCCGG - Intronic
1167502242 19:49854809-49854831 TCTGACCAGCTCCTTCCCATAGG + Exonic
1167767260 19:51491751-51491773 CCTGGCCACCCCCTCCCCAGAGG - Exonic
1168564731 19:57413574-57413596 CATGGCCTGCCTCTTCCCACAGG + Intronic
926101790 2:10122646-10122668 GGTGCCCCGGCCCTTCCCATTGG - Exonic
927102480 2:19798786-19798808 CCTGCCCCACCCCATCCCACTGG + Intergenic
929694344 2:44101293-44101315 CCTGCCCAGCCCCTCCCCAGAGG + Intergenic
929934710 2:46286336-46286358 CCTGGTCAGCTCCTTCCCAGTGG - Intergenic
932588495 2:73047505-73047527 CCTGGCCCCGCCCTTGACATGGG - Intronic
934736920 2:96694239-96694261 CCCTGCCAGCCCCTACCCATGGG + Intergenic
935708291 2:105875361-105875383 CCTGCCCCGCCCAGTCCCCTGGG + Intronic
936090953 2:109501142-109501164 CCTCCCCCGCCCCTGCCCCTGGG + Intronic
936536968 2:113320088-113320110 CCTGGCTCACCCCTGCACATGGG + Intergenic
937956677 2:127425684-127425706 CCTGGCCTGACTCTTGCCATTGG + Intronic
938033356 2:128014823-128014845 CCTGGGCCCCCTCTTCACATTGG - Exonic
939971819 2:148670715-148670737 CCTGTCCCCTCCCTTCCCCTCGG + Intronic
941864343 2:170318479-170318501 CCTAGCCCTCCCCATCCTATTGG - Intronic
944094761 2:195953531-195953553 CCACAGCCGCCCCTTCCCATGGG + Intronic
945921950 2:215763791-215763813 CCTGGCCCCGCCCTTGACATGGG + Intergenic
946440664 2:219692613-219692635 CCTGGCCCGCCTTCCCCCATGGG + Intergenic
948174949 2:235935970-235935992 CCTGGCCCGGCCCTCCCCGCTGG + Intronic
948252515 2:236541717-236541739 CCTGGCCCCACCCTTGACATTGG - Intergenic
948580763 2:238986112-238986134 CCCGGCCCGCCCCTTCCCAGTGG + Intergenic
948584658 2:239011784-239011806 CCTGGCGAGCCGCTTCCCAGGGG + Intergenic
948664995 2:239529104-239529126 CCTGAGCCTCCCCTGCCCATGGG - Intergenic
948918870 2:241052225-241052247 CCTGGACCAGCCCTGCCCATGGG - Intronic
949027658 2:241774007-241774029 CCTGCCTCGCCCCTCCCCACAGG + Intergenic
1170957205 20:20992060-20992082 CATGCCCTGCCCTTTCCCATTGG + Intergenic
1171253397 20:23667810-23667832 CCTGCCCCGCCACCTCTCATAGG - Intergenic
1171268948 20:23798595-23798617 CCTGCCCCGCCACCTCTCATAGG - Intergenic
1171349280 20:24490521-24490543 CCTGGCTCGCCCCTAGCCCTTGG + Intronic
1174413025 20:50348325-50348347 CCTGCCCCCACCCCTCCCATGGG + Intergenic
1175748779 20:61480525-61480547 CCAGGCCCCTCCCTTCCCAGTGG + Intronic
1175971805 20:62690131-62690153 CCTGGCCCCCTCCCTCGCATCGG + Intergenic
1176241189 20:64076702-64076724 CCTCTCCCCCACCTTCCCATGGG + Intronic
1178915732 21:36704786-36704808 CCTTCCCTGCCCCTCCCCATCGG + Intronic
1180023807 21:45147018-45147040 CCTGGCCAGCCCCTCCTCAGGGG + Intronic
1180938392 22:19641172-19641194 CCTGGCTCCCTCCTTCCCTTCGG + Intergenic
1181121268 22:20669753-20669775 CCTGGCCCTCCCCAGCCCACTGG - Intergenic
1181796173 22:25312551-25312573 CCTGGCCCATGCCTCCCCATCGG - Intergenic
1181836720 22:25616161-25616183 CCTGGCCCATGCCTCCCCATCGG - Intronic
1181968157 22:26671121-26671143 TCTGGTCAGCCCCTTCCCAGAGG - Intergenic
1182295884 22:29311111-29311133 CCAGGCCCGCCCCCACCCACGGG - Intronic
1182547812 22:31085755-31085777 TCTGGCACGACCCTTCCCTTTGG - Intronic
1182568598 22:31218759-31218781 CCTGACCCGCCAGTTCCCAAGGG + Intronic
1183102905 22:35594740-35594762 CCTGGTCTGCCTCTTCCCAGAGG - Intergenic
1183196163 22:36355038-36355060 GCTGGCCTGCCCATTCCCACAGG - Intronic
1183492822 22:38125918-38125940 CCAGGCCCGCCTCTTACAATGGG + Intronic
1183969907 22:41469064-41469086 CCGGGCACGCCCCTGCCCAAAGG + Intergenic
1184177379 22:42795911-42795933 ACTGCCCCTCCCCTTCCCCTCGG - Intergenic
1184998138 22:48225534-48225556 CCTGGCCTGCCACTTCCTTTAGG + Intergenic
1185049390 22:48545932-48545954 CCTGGCACTCCCCTTCCCCAGGG - Intronic
1185138965 22:49089636-49089658 GCTGGCCCGCCCCTCCCCTGGGG + Intergenic
950799587 3:15539330-15539352 TCTGCTCAGCCCCTTCCCATGGG - Intergenic
953356417 3:42259981-42260003 CCTTGCCAGCTCCTACCCATAGG + Intronic
953821017 3:46207428-46207450 CCTGGCCAGCTCCTTGCCTTTGG + Intronic
953876724 3:46670900-46670922 CCTGTCCTGCCCCTTGCCTTGGG + Exonic
954116227 3:48468322-48468344 GCTGGCCCTGCCCTTCCCACAGG - Exonic
954763805 3:52896939-52896961 CCTTGTCCGCCCCTTCTCAGGGG - Intronic
960054981 3:113270779-113270801 CCTGGCCCTGCCCTTTCCACAGG + Exonic
962085714 3:132189520-132189542 CCCGGCCCGCCTTTTCCCCTGGG - Intronic
967887440 3:194342629-194342651 CCTGCCCAGCCCTGTCCCATGGG - Exonic
967947631 3:194816757-194816779 CCTGGCCCGCTGCTTCCCCCTGG + Intergenic
968130518 3:196190320-196190342 TCTGGCCAGCTCCTTCCCCTAGG + Intergenic
968135331 3:196216389-196216411 TCTGGCCCGGCCCATCCTATAGG - Intronic
969078365 4:4598849-4598871 CTTGGCCAGCCCCTGCCCCTTGG - Intergenic
969244298 4:5922534-5922556 CCACGCCTGCCCCTTCCCGTGGG - Intronic
969346928 4:6575692-6575714 CCAGCCCGGCCCCTTCCCAGCGG - Intronic
969423544 4:7110871-7110893 CCGTGCCTGCCCCTTTCCATGGG + Intergenic
971253066 4:24989292-24989314 TCTGGCCCTCCCCTTCCCTCTGG - Intergenic
972395763 4:38658416-38658438 CCTGGACCGCACCATCCCCTAGG + Intergenic
976064625 4:81171160-81171182 CCTCCCCCACCCCTCCCCATTGG + Intronic
976534826 4:86199581-86199603 CCCTGCACGCCCCTTCCCAGTGG - Intronic
984811289 4:183798076-183798098 CCCGTCCCGTCCCTTCCCACCGG + Intergenic
985722458 5:1496888-1496910 CCTGGGCAGCCCATTCCCAGGGG + Intronic
993609060 5:90032054-90032076 CCATGGCCGCCCCTTCCCCTAGG - Intergenic
996120481 5:119666235-119666257 TCTGTCCCGCCCCCTCCCACTGG - Intergenic
997440619 5:133906361-133906383 CCTGGCCAGAACCTTCCCATGGG + Intergenic
997512807 5:134465178-134465200 ACTGGCTGGCCCCTGCCCATAGG - Intergenic
998044451 5:138975193-138975215 GCTGACCAGCCCCTTCCTATAGG - Intronic
998130397 5:139648776-139648798 CCTGCCCCGCCCCTCCCCCTCGG + Exonic
998414600 5:141937051-141937073 CCTGGCCCGCCCCATAGCAAGGG - Intronic
999295937 5:150459428-150459450 CCTGGCACTGCCCTTCCCTTTGG - Intergenic
1001721265 5:173859083-173859105 CCTTGGCAGCCCCTTCCCAAAGG + Intergenic
1002845362 6:940236-940258 CCTGGCCCATCCCTTTTCATGGG - Intergenic
1003315012 6:5004063-5004085 CCCGCCCCGCCCCTTCCCTCCGG + Intronic
1003503903 6:6724658-6724680 CCTGGGGCGCCCCTTCCCCGGGG + Intergenic
1004864378 6:19838281-19838303 CCTGGCCCGCCCCTGCCCGGAGG - Intronic
1005825040 6:29627592-29627614 CCTGGCCAGCCCCCGCTCATGGG + Exonic
1006504035 6:34476629-34476651 CCTTGCCAGCCCCTTGTCATTGG + Intronic
1006516862 6:34550154-34550176 CCTGCCCTGCCCCATCCCCTTGG + Intronic
1007622114 6:43221629-43221651 CCTGGCACACCCCTGCCCAGAGG + Intronic
1008563972 6:52749384-52749406 CCTGGCAAGCTCCTTCCCAGTGG - Intergenic
1008568285 6:52790671-52790693 CCTGGCAAGCTCCTTCCCAGTGG - Intergenic
1008581659 6:52913666-52913688 CCTGGCAAGCTCCTTCCCACTGG - Intergenic
1014670867 6:124302035-124302057 CCTGGCCCCACCCTTGACATGGG - Intronic
1018064427 6:160115583-160115605 CCTGCCACTCCCCTCCCCATGGG - Intergenic
1018398100 6:163396480-163396502 CCTGGCCTGGCTCTTCCCAGTGG - Intergenic
1018890042 6:167976744-167976766 CCTGGACCGGCCCTTCCCAGAGG - Intergenic
1019718751 7:2555399-2555421 CCTGGCCCGCCCGCCCCCCTCGG + Intronic
1019939587 7:4278734-4278756 CCTGGCCAGCCCATTCCCCTGGG + Intergenic
1020445173 7:8261431-8261453 CCTGGCGCGCCCGTTTCCTTTGG - Intronic
1022675676 7:32496347-32496369 CTTTGCCTCCCCCTTCCCATTGG + Intronic
1023134538 7:37038198-37038220 CCTCACCCTCCCCATCCCATTGG + Intronic
1023752722 7:43387211-43387233 CCCAGCCAGCCCCTTCCCTTGGG + Intronic
1029283275 7:99450229-99450251 CCTGGCCCCGGCCTTCCCAGTGG + Intronic
1029627535 7:101729697-101729719 CCTGGGCCACACCTTCCCACAGG + Intergenic
1033260599 7:139840760-139840782 CCTGGACCACCCCTACGCATGGG - Intronic
1033290731 7:140080590-140080612 CCTGACCCACCCCATCCCACTGG + Intergenic
1033360732 7:140637414-140637436 CCTGGCCAGGCTCTTCCCTTTGG - Intronic
1034462928 7:151208233-151208255 CCTCACCAGCCCCTTCCCAGAGG + Intronic
1035443636 7:158924348-158924370 CCTGCACCGCCCCTTCCCGTAGG + Intronic
1036631975 8:10522223-10522245 CCCGGCCCGCCCCATCCCACTGG + Intergenic
1036733301 8:11284770-11284792 CCCGGCCCGCCCCGCCCCACGGG + Exonic
1036775913 8:11613175-11613197 GCTGGCCGGCCCCTTCCAACTGG + Intergenic
1037143084 8:15540594-15540616 CCTGGCCCGCCCCCGCCCACAGG - Intronic
1037193166 8:16152359-16152381 CCTGGCCCGCCCCTTCCCATAGG - Intronic
1037767264 8:21779938-21779960 CCAGCCCCTCCCCTTCCCAAAGG + Intronic
1038641317 8:29331334-29331356 CCTGGAACACCCCTCCCCATTGG - Intergenic
1039477071 8:37844691-37844713 ACTGGCCGGCCGCTTCCCCTGGG + Exonic
1042963121 8:74323271-74323293 CCTGGCCCTCATCTTCCCAGCGG - Intronic
1044940204 8:97334735-97334757 CCAGAGCCGCCCCTTCCCCTGGG + Intergenic
1047580748 8:126212537-126212559 CCTGGGTCACCCCTTCCCAAAGG - Intergenic
1049220391 8:141426265-141426287 CCTGGCCCGGGCCCTCCCCTAGG + Intronic
1049409588 8:142466510-142466532 CCTGGCCCCCCACTGCCCAGGGG - Intronic
1049743098 8:144250340-144250362 CCTGGGCAGCCCCTTGCCCTTGG + Exonic
1049850173 8:144826665-144826687 CCTGACGCGCCCCTCCCCACGGG - Intergenic
1050721812 9:8599911-8599933 CCTGGCCGGCCCCTCCCCTTTGG + Intronic
1053604677 9:39645224-39645246 CCTGGCCCTCCCCATCGCCTAGG - Intergenic
1054248865 9:62697192-62697214 CCTGGCCCTCCCCATCGCCTAGG + Intergenic
1054562975 9:66731718-66731740 CCTGGCCCTCCCCATCACCTAGG + Intergenic
1058701044 9:107600500-107600522 CCTGTCCTGCCTCTTCCCAGGGG + Intergenic
1059443458 9:114323878-114323900 CCTGGCCTTGGCCTTCCCATGGG + Intronic
1059444649 9:114330649-114330671 CCTGGCCTTGGCCTTCCCATGGG + Intronic
1061048917 9:128182669-128182691 CCAGGCCCGTCCCTGCCCCTAGG + Intronic
1061306329 9:129735343-129735365 CCTGGCCCTCCCCATCCCCGAGG + Intergenic
1061624878 9:131835713-131835735 GCTGGCCTGCGCCTTCCCAGAGG - Intergenic
1061781290 9:132997620-132997642 CTTGGCCAGCCTCCTCCCATGGG - Intergenic
1062193141 9:135257821-135257843 CCTGGCCTGGCCCATCCCCTGGG - Intergenic
1062273301 9:135719521-135719543 CCTGCCCCACCCCTCCCCACTGG - Intronic
1062306059 9:135907631-135907653 CCTGCCCCGCCCCTTTCCGCAGG + Intergenic
1062306091 9:135907733-135907755 CCTGCCCCGCCCCTTTCCGCAGG + Intergenic
1062436406 9:136548338-136548360 CCTAGCCCCCACCCTCCCATTGG - Intergenic
1062443738 9:136584703-136584725 CCTCGCCCTCCGCTTCCCACGGG + Intergenic
1186209240 X:7232500-7232522 CCTTGCCAGCCTCTTCCCCTTGG - Intronic
1186507012 X:10101550-10101572 CCTGGCTTGCCCCGTCCCAGGGG - Intronic
1189472048 X:41322174-41322196 GCTGGCCCTGCCCTTCCCACAGG - Intergenic
1189674196 X:43444088-43444110 GGTGGCCTGCCCCTTCCCCTGGG + Intergenic
1190977140 X:55416704-55416726 GGTGGCCCGCCCCTCCCCCTGGG - Intergenic
1192758122 X:74066990-74067012 GCTGGCCCTGCCCTTCCCACAGG + Intergenic
1196932477 X:120695652-120695674 GGTGGCCCACCCCTTCCCCTGGG - Intergenic
1198912955 X:141634412-141634434 CCTGGCCCAACCCTTGACATGGG - Intronic
1199864117 X:151827661-151827683 CGTGCCCTGCCTCTTCCCATAGG + Intergenic
1200145866 X:153926335-153926357 CCTGGGCCGCCCCGCCCCACCGG - Intronic
1200864879 Y:8032998-8033020 CCTGCCACTGCCCTTCCCATAGG + Intergenic
1202498269 Y:25461683-25461705 CCAGGCCTGCCCCTTCCCTCTGG - Intergenic