ID: 1037199148

View in Genome Browser
Species Human (GRCh38)
Location 8:16229519-16229541
Sequence CTTCTTGCTGTGTCATCCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4177
Summary {0: 4, 1: 89, 2: 311, 3: 1232, 4: 2541}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037199148_1037199151 -6 Left 1037199148 8:16229519-16229541 CCATAGGATGACACAGCAAGAAG 0: 4
1: 89
2: 311
3: 1232
4: 2541
Right 1037199151 8:16229536-16229558 AAGAAGGCCCCCACCAGGTGTGG No data
1037199148_1037199157 8 Left 1037199148 8:16229519-16229541 CCATAGGATGACACAGCAAGAAG 0: 4
1: 89
2: 311
3: 1232
4: 2541
Right 1037199157 8:16229550-16229572 CAGGTGTGGCTTTTTGACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037199148 Original CRISPR CTTCTTGCTGTGTCATCCTA TGG (reversed) Intronic
Too many off-targets to display for this crispr