ID: 1037203128

View in Genome Browser
Species Human (GRCh38)
Location 8:16282295-16282317
Sequence CAGAGTGGCATCACAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 299}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037203128 Original CRISPR CAGAGTGGCATCACAGAGGA AGG (reversed) Intronic
900519542 1:3098953-3098975 CTGAGCGGCCTCACTGAGGAGGG + Intronic
900587937 1:3442387-3442409 CAGAGAGGCAGGACAGAGCAGGG + Intergenic
902464037 1:16603574-16603596 CCGAGTGGCATGAGACAGGATGG + Intronic
903157066 1:21453101-21453123 CCGAGTGGCATGAGACAGGATGG - Intronic
905123793 1:35702852-35702874 AAGAGTGGAATTACAGAGGCTGG - Intergenic
906804783 1:48770171-48770193 CAGTTTTGCACCACAGAGGAAGG - Intronic
907272654 1:53299926-53299948 CAGAGTGGGCTGACAGAGGGAGG + Intronic
907383297 1:54109120-54109142 CTGAGTGGGAGCACAGTGGAGGG + Intronic
907475411 1:54702038-54702060 GTGAGTGGCGTCCCAGAGGAGGG + Intronic
907707324 1:56844161-56844183 CAGAGCGGCATCAGGGAGGAGGG - Intergenic
908044577 1:60154836-60154858 CAGTGTGTCAACACAGTGGAAGG + Intergenic
908562171 1:65317952-65317974 CACAGTGGCATCATAGTGCATGG + Intronic
909517849 1:76532455-76532477 CAGAGTGGAATCAGAGTGAAGGG - Intronic
910711620 1:90187928-90187950 TAGAGTGGCATAACTGAGAAAGG + Intergenic
912390432 1:109298815-109298837 CAGAGTGGCCATGCAGAGGAAGG - Intronic
913992552 1:143627972-143627994 CTGAGTGGCATAAGACAGGATGG + Intergenic
915603854 1:156938793-156938815 CAGAGTGGAATCCCAGGGGAGGG + Intronic
916168591 1:161984305-161984327 CAGAGTGGCATGGCAGAGGGTGG + Intronic
916952677 1:169796576-169796598 CAGAGTGGTAGCAATGAGGATGG - Intronic
917534864 1:175867082-175867104 CAGAGTGGGATCCCAGTGGAAGG - Intergenic
918794310 1:188873303-188873325 CAGAGTAGCAACCCAGAGGCAGG - Intergenic
920161771 1:204004107-204004129 CACAGTGCGAGCACAGAGGAGGG + Intergenic
920376506 1:205511334-205511356 CAGAGTGGCGACAGAGACGATGG + Intronic
920628636 1:207629268-207629290 CAGGGAGACTTCACAGAGGATGG - Intronic
921166074 1:212508161-212508183 CAGAGTAGCAGGGCAGAGGAGGG - Intergenic
921415919 1:214886697-214886719 GAGAGAGGCTTCCCAGAGGAAGG - Intergenic
921482502 1:215679137-215679159 CAGAGAGGCAGCCCACAGGATGG + Intronic
922093325 1:222418611-222418633 CAGAATGGCACCACAGTGAAAGG + Intergenic
922825001 1:228511796-228511818 AAAAGTGGCAGTACAGAGGAAGG - Intergenic
924012170 1:239677101-239677123 GAGGGTGACATCACAGAGCAGGG - Intronic
924108116 1:240669731-240669753 GAGAGTGGAATGACAGACGATGG - Intergenic
1062974909 10:1675880-1675902 CTGAGTGGCAGCTCAGAGGAAGG + Intronic
1066352335 10:34647923-34647945 GAGAATGGGATCAAAGAGGAGGG + Intronic
1067220795 10:44342938-44342960 CAGACTGGTATAAAAGAGGAAGG + Intergenic
1068057579 10:52030038-52030060 CAGGGATGCATCACAGAGTAAGG - Intronic
1069829428 10:71273487-71273509 CAGAGGGTCTTCTCAGAGGAGGG - Intronic
1070747609 10:78944098-78944120 CAGAGTGGGATCAAGGAGAAAGG + Intergenic
1072554485 10:96504263-96504285 CTCAGTGGCCTCACTGAGGATGG - Intronic
1073625949 10:105097058-105097080 CAGAGAAGCAGCACAGAGCATGG + Intronic
1073965333 10:108982379-108982401 CAGAGGGGCATGAGAAAGGACGG + Intergenic
1074109814 10:110414860-110414882 CAGTGAGGCTTCTCAGAGGAAGG - Intergenic
1074278492 10:112027691-112027713 CTGAGTGGCATCAAAGAAGAGGG + Intergenic
1074962370 10:118458764-118458786 TAGGGAGGCATCCCAGAGGAGGG + Intergenic
1075086416 10:119417156-119417178 CTCAGTGGCATTACAGAGGTAGG - Intronic
1075345845 10:121681477-121681499 CAGAGGGGCAGCACACATGATGG - Intergenic
1076261317 10:129069251-129069273 TGGAGTTGCCTCACAGAGGACGG - Intergenic
1076645542 10:131951936-131951958 CAGAGTGGCAACACAGTGCAGGG + Intronic
1077198100 11:1291550-1291572 CAGAGGGGCGTCAGTGAGGATGG - Intronic
1078080249 11:8199127-8199149 CAGAGTGGCTACCCAGAGGGAGG + Intergenic
1082189913 11:49230651-49230673 CAGCCAGGCTTCACAGAGGATGG + Intergenic
1082820696 11:57542870-57542892 CAAAGTGGAATCTCAGAGGGAGG + Exonic
1084699686 11:70778307-70778329 CAAAATGGCCCCACAGAGGATGG + Intronic
1086329341 11:85738055-85738077 CTCAGTGGCATCACAGAGTCAGG + Intronic
1088228543 11:107648417-107648439 CAGATTGACATCACAGCGGGAGG + Intronic
1089353679 11:117836179-117836201 CAGGGAGGCTCCACAGAGGAGGG + Intronic
1090258419 11:125302123-125302145 CAGAGAGGCCTCACAGAGAAGGG + Intronic
1090652824 11:128822600-128822622 TAGAGTGGCTTCATAGAAGATGG + Intergenic
1090843485 11:130512855-130512877 CAGAGCCTCAGCACAGAGGATGG + Intergenic
1091046442 11:132329974-132329996 CAGAGGGGGGTCACATAGGAGGG + Intronic
1091149850 11:133318083-133318105 CAGTGGGACATCACAGAGGCAGG - Intronic
1091240324 11:134047686-134047708 CAGAGAGCCAGCAGAGAGGAAGG + Intergenic
1091339231 11:134797515-134797537 CAAAATGGCATCACCGAGGCTGG - Intergenic
1092012722 12:5128390-5128412 GAGTGTGGCATCACAGTGGAAGG - Intergenic
1096805872 12:54140887-54140909 CACAGGGGCATGAAAGAGGAAGG - Intergenic
1097160478 12:57043181-57043203 TAGGGTGGCATCACAGAACAGGG + Intronic
1097639409 12:62161515-62161537 GAGAGTGGAATGATAGAGGATGG + Intronic
1098098709 12:66989280-66989302 CAGAGTAGCAACAAAGAAGAAGG - Intergenic
1099516452 12:83601861-83601883 AAGCCTGGCATAACAGAGGAGGG - Intergenic
1099893579 12:88618254-88618276 CACAGTGGGAGCACAGAGGAAGG + Intergenic
1099902835 12:88734031-88734053 CAGAGTGAACTCATAGAGGAGGG + Intergenic
1100328463 12:93564262-93564284 CAGAAAGGCATCACAGTAGAGGG - Intergenic
1100717861 12:97324716-97324738 CAGAGGGGCATCACAGATCAGGG + Intergenic
1100793735 12:98158149-98158171 AAGAGTGGCATGACCAAGGAGGG + Intergenic
1100958914 12:99940846-99940868 AGGAAGGGCATCACAGAGGAAGG + Intronic
1101871187 12:108566754-108566776 CCGAATGGCATCAGAGAGGTTGG - Intronic
1104044093 12:125149644-125149666 GAGAATGTCAACACAGAGGAAGG - Intergenic
1105019481 12:132806297-132806319 GAGAGTGGCTACACAGAGGAGGG + Intronic
1105210626 13:18254781-18254803 CTGTCTGTCATCACAGAGGACGG - Intergenic
1105893854 13:24701684-24701706 TAAAGTGGCATCAAAGGGGAAGG + Intronic
1106504073 13:30356084-30356106 CAGAGTGGCAGCTGAGAGGCAGG - Intergenic
1106843393 13:33710456-33710478 CAAATTAGCATCTCAGAGGAAGG - Intergenic
1107904642 13:45050866-45050888 CAGAGTGGAAGCACAGAAGAAGG - Intergenic
1108562401 13:51658588-51658610 CAGAGTAATATCACAGAAGATGG - Intronic
1108967636 13:56330160-56330182 CAGATTGTGAGCACAGAGGAAGG - Intergenic
1109202235 13:59443648-59443670 GAGAGTGGCATAAAAGATGAGGG - Intergenic
1111747463 13:92288707-92288729 CAGAATGGTATCACAGAAGATGG - Intronic
1112876321 13:104044137-104044159 CATAATGGCAGCACAGAGGCGGG - Intergenic
1112887871 13:104195669-104195691 CAAAGTGCTATCACAGAGGAAGG - Intergenic
1114705548 14:24722652-24722674 CAAAGTGCCTTCACAGAGTAGGG - Intergenic
1114849040 14:26360214-26360236 CAGAGCGGCGGCACACAGGAGGG - Intergenic
1114873480 14:26686601-26686623 GATAGTGGCATGACAGAGGCTGG + Intergenic
1115240744 14:31249794-31249816 AAGAGTAGCAACACAGAGAAGGG + Intergenic
1115474817 14:33802763-33802785 TAGGGTGACATTACAGAGGAAGG - Intronic
1117752952 14:58942700-58942722 CAGAGTGCAAACACAGAGCAGGG - Intergenic
1120679533 14:87463836-87463858 CCGCGTGGCATCTCAGAAGAGGG - Intergenic
1121148283 14:91605725-91605747 GAGAGTGGTAACAGAGAGGAGGG - Intronic
1122045116 14:99017557-99017579 CAGAGAGGGAACCCAGAGGAAGG - Intergenic
1122278585 14:100608281-100608303 CAGAGTGGAATCACTGGGGTAGG - Intergenic
1122410442 14:101523042-101523064 CACAGAGGCATCACAGGGGCTGG - Intergenic
1122459065 14:101880114-101880136 CACACTAGCTTCACAGAGGAGGG + Intronic
1123115935 14:105894054-105894076 CACAGCGGCCTCTCAGAGGAGGG + Intergenic
1123117962 14:105903164-105903186 CACAGCGGCCTCTCAGAGGAGGG + Intergenic
1123120174 14:105912769-105912791 CACAGCGGCCTCTCAGAGGAGGG + Intergenic
1123219268 14:106841344-106841366 CTGGGTGGCCTCCCAGAGGAGGG + Intergenic
1123402908 15:20004355-20004377 CATAGTGGCCTCTCAGAGGAGGG + Intergenic
1123512247 15:21011009-21011031 CATAGTGGCCTCTCAGAGGAGGG + Intergenic
1123708631 15:22969140-22969162 CACATTTGCATCACAGGGGAGGG - Intronic
1125332451 15:38595406-38595428 CTCAATGGCATCACAGAGGAGGG - Intergenic
1125422464 15:39518345-39518367 CTCAGTTGCAGCACAGAGGAAGG + Intergenic
1125842557 15:42817958-42817980 TAGAGTGGCACCACAGATGGGGG - Intronic
1125926040 15:43563992-43564014 CAGGGTGTCAACACAGTGGAAGG + Intronic
1125939184 15:43663543-43663565 CAGGGTGTCAACACAGTGGAAGG + Intronic
1127579032 15:60320315-60320337 CAGAGTCACACCACAGAGGGTGG + Intergenic
1127832576 15:62763824-62763846 CAGATTGGCTCCACAGAGAATGG - Intronic
1128233560 15:66051943-66051965 CATAATGGCATCACTTAGGAGGG - Intronic
1130699291 15:86162839-86162861 CAGCATGGCATTCCAGAGGAAGG - Intronic
1130959171 15:88648423-88648445 TAGAGTGGAAACACAGTGGAAGG + Intronic
1132766795 16:1538451-1538473 CAGAATGGCATGACCGAGGTGGG - Intronic
1133404417 16:5511555-5511577 CTGAGTGGCATCTAGGAGGAGGG - Intergenic
1133837101 16:9377192-9377214 CAGAGAGGCAGCAGAGTGGATGG - Intergenic
1134560186 16:15202357-15202379 AAGAGTGACATATCAGAGGAAGG + Intergenic
1134920727 16:18113967-18113989 AAGAGTGACATATCAGAGGAAGG + Intergenic
1135551362 16:23400646-23400668 CAGAGTGGCTTGAAATAGGAGGG + Intronic
1135783430 16:25326465-25326487 CAGAGTAGCAGCTCAGAGGCAGG + Intergenic
1136689379 16:32017981-32018003 CAGAGTAGCAGCTCAGAGGTGGG - Intergenic
1136789971 16:32961523-32961545 CAGAGTAGCAGCTCAGAGGTGGG - Intergenic
1136879841 16:33892413-33892435 CAGAGTAGCAGCTCAGAGGTGGG + Intergenic
1137403708 16:48174050-48174072 CAGAAAGGCTTCCCAGAGGAGGG - Intronic
1138262564 16:55635741-55635763 CAGAGTGACACCACTCAGGAAGG - Intergenic
1138432188 16:56976005-56976027 GAGAGAGGCATCACAGAGCCGGG - Intronic
1139609889 16:68048419-68048441 CAGTGTGGCATCCCAAGGGATGG - Intronic
1140657336 16:77154250-77154272 CAGAGTGGCCTCACTGAAGGTGG + Intergenic
1140733194 16:77874608-77874630 CAGAGAGGCATCCCTGGGGAAGG - Intronic
1141597912 16:85108414-85108436 GGGAGTGTCATCACTGAGGAGGG + Intronic
1203092174 16_KI270728v1_random:1222986-1223008 CAGAGTAGCAGCTCAGAGGTGGG - Intergenic
1143437824 17:6942307-6942329 CAGAGTAGCAGCTCAGAGGCAGG - Intronic
1144590659 17:16520989-16521011 CAGAGTTGGAGCAGAGAGGATGG + Intergenic
1146565499 17:33909494-33909516 CAGAGTGGAACCACGGAGCATGG + Intronic
1147152225 17:38524126-38524148 CAGAGTAGCAGCTCAGAGGTGGG - Intergenic
1148512511 17:48184532-48184554 GAGAGTGGCAACAGAGGGGAGGG + Intronic
1148668670 17:49393809-49393831 CAGAGTAGCAGCTCAGAGGCAGG - Intronic
1149497130 17:57126116-57126138 CAGAGTGGCATGGCAGGTGAGGG + Intergenic
1150013086 17:61524651-61524673 CAGAGTAGCAGCTCAGAGGCAGG - Intergenic
1153747764 18:8198020-8198042 CAGAGTGTCCACACAGAAGAAGG - Intronic
1155226972 18:23737432-23737454 CAGAGTGACATCGCAGGGCAGGG - Intronic
1155667914 18:28333857-28333879 GAGGATGGCATGACAGAGGATGG + Intergenic
1156487439 18:37475516-37475538 TAGAGGAGCATCACAGAGGAAGG + Intronic
1157147713 18:45181429-45181451 CACTGTGGCCTCACAGAGGGAGG + Intergenic
1157555140 18:48608569-48608591 CAGGGTGGCATCTAAGAGGTGGG + Intronic
1159461043 18:68723098-68723120 CAGGGTGGCAGGACAGAGAATGG + Intronic
1160062873 18:75548714-75548736 CAGAGTGGCAGCTCAGGGGCAGG - Intergenic
1161300901 19:3542859-3542881 CAGGGGGGCTTCCCAGAGGAAGG + Intronic
1161528223 19:4770565-4770587 CAGGGAGGCAGCACAGAGGCAGG + Intergenic
1163350316 19:16772816-16772838 CAGAGTGTGATAAAAGAGGAAGG + Intronic
1164100086 19:22047090-22047112 GAGAGTGTCATCACAGAGCCTGG - Intergenic
1165242041 19:34476720-34476742 CAGCGTGGCAGCACACAGGATGG + Intergenic
1165369949 19:35398790-35398812 CAGATTGGGAGAACAGAGGAAGG - Intergenic
1166349543 19:42189196-42189218 CAGGGAGCCATTACAGAGGATGG - Intronic
1167169441 19:47821602-47821624 GAGAGAGGCATCAAAGAGGAAGG - Intronic
1167566797 19:50261835-50261857 AAGACTGGCAACACAGAGGCTGG + Intronic
1167889578 19:52528600-52528622 GAGAGTGGCAGCAAAGAGGGAGG + Intronic
1167945099 19:52981767-52981789 CAGAGTGACATCTCAGGTGAAGG + Intergenic
1202679696 1_KI270711v1_random:41014-41036 CCGAGTGGCATGAGACAGGATGG + Intergenic
925322976 2:2991115-2991137 CAGAGTGACCTCACTGAGGGTGG - Intergenic
928268938 2:29837241-29837263 GAGAGTGACATCACAAAAGAAGG + Intronic
929658185 2:43755208-43755230 CAGAATGTGAACACAGAGGAGGG - Intronic
932419083 2:71590868-71590890 CAGTGTGACATTAAAGAGGAGGG - Intronic
938398410 2:130967370-130967392 CAGTGTGGCAGCACAGCTGATGG - Intronic
938514597 2:131989944-131989966 CTGACTGGCTTGACAGAGGATGG - Intergenic
939764445 2:146228814-146228836 CAGAGTGTCACCACAGAGTTGGG + Intergenic
942930208 2:181482598-181482620 CAGAGCACCATCAGAGAGGAAGG + Exonic
943434397 2:187846474-187846496 GAGAATGACAGCACAGAGGATGG + Intergenic
945601778 2:211876357-211876379 AAGAATGGCAAGACAGAGGAAGG + Intronic
946513949 2:220391544-220391566 CGCAGTGGCGGCACAGAGGATGG + Intergenic
947447773 2:230177713-230177735 CAGGGTGAATTCACAGAGGATGG - Intronic
1169208669 20:3753891-3753913 CAGGGTGGCAGCACAAATGAAGG + Exonic
1170329152 20:15189598-15189620 CAGGGAGGCATCAAAAAGGAGGG - Intronic
1170958718 20:21005219-21005241 CAGAGTGACATAATAGATGATGG - Intergenic
1172762709 20:37333382-37333404 AAGGGTGGGATCCCAGAGGAGGG + Intergenic
1172783814 20:37452637-37452659 CTGAGTGTCAGCACAGAGGAAGG + Intergenic
1174552282 20:51370636-51370658 CAGAAGGGCTTCCCAGAGGAAGG + Intergenic
1174830206 20:53805456-53805478 CAGGATGGCATCACAGAGGGAGG - Intergenic
1175522230 20:59609278-59609300 CAGAGTGGCATAAAAGAGGAAGG - Intronic
1175557014 20:59871512-59871534 CAGAGTAGCATCAAAGATGGTGG + Intronic
1176365530 21:6030409-6030431 CAGAGTGGGATCTAAGAGAAAGG + Intergenic
1176752229 21:10700144-10700166 CAGAGTGGAATGAAAGAGAATGG - Intergenic
1177560354 21:22743347-22743369 CAAAGTGGCAACAAAGAAGAGGG + Intergenic
1177976826 21:27861996-27862018 CTGACTGGCTTGACAGAGGATGG + Intergenic
1178597044 21:33963530-33963552 CAGAAAGGCTTCACAGAGAAGGG - Intergenic
1178804464 21:35826836-35826858 GAGTTTGGCATCACAGAGCATGG - Intronic
1179404082 21:41111128-41111150 AAGAGTGGTACCAGAGAGGAAGG + Intergenic
1179757988 21:43508136-43508158 CAGAGTGGGATCTAAGAGAAAGG - Intergenic
1181421917 22:22806719-22806741 CAGAGTGGCATCATGGAAGATGG + Intronic
1182013844 22:27022647-27022669 CAGAGTGGCTGCAAAGACGATGG - Intergenic
1182994590 22:34800858-34800880 CAGAGTGTCGGAACAGAGGATGG - Intergenic
1184851227 22:47122380-47122402 CAGTGTCCCATCACAGAGGAGGG + Intronic
1185302633 22:50090384-50090406 CGGAGAGACCTCACAGAGGACGG - Intronic
1185414159 22:50700680-50700702 CAGTGTGGCATCATGGCGGAGGG + Intergenic
950703893 3:14768331-14768353 CAGAGCAGCATCATAGAGGGAGG - Intronic
951072854 3:18352399-18352421 CAGATTTGCATCTCAAAGGAGGG + Intronic
951867452 3:27324034-27324056 CATAGAGGCATGACAGTGGAGGG - Intronic
952741204 3:36736820-36736842 CAAAGTGGCATCTCAGTGGGAGG + Intronic
953104916 3:39868138-39868160 CTGAGGTCCATCACAGAGGATGG + Intronic
953422393 3:42764663-42764685 CCCAGTGGCATCTCAGAGGCTGG + Intronic
953873132 3:46644954-46644976 CAGAGTGGCAGCTCAGAGACAGG + Intergenic
954425441 3:50440633-50440655 CAGTGTGGGAGCAGAGAGGAGGG + Intronic
954426567 3:50446530-50446552 CAGAGTGGCTTCCCAAAGGAGGG - Intronic
955565223 3:60237181-60237203 CAGACTGGCTTCCCAGAGTATGG + Intronic
962612492 3:137091312-137091334 CACTGGGGCCTCACAGAGGATGG - Intergenic
963274184 3:143314022-143314044 CACAGTGGGAGCCCAGAGGAGGG - Intronic
964278673 3:155037529-155037551 CTGAGTGAAATCACAGAGAACGG + Intronic
964416604 3:156454477-156454499 CAGAGAGGGCTGACAGAGGAAGG + Intronic
964499041 3:157327899-157327921 TAGAGTGGCTTCTGAGAGGAAGG - Intronic
964781766 3:160346975-160346997 CAGAGTGGCATCAACGAATAAGG - Intronic
965165515 3:165190792-165190814 CTGAGATGCTTCACAGAGGAAGG - Exonic
965202548 3:165677854-165677876 CACAGTGGCCTCTCAGAGGCAGG + Intergenic
966173243 3:177106722-177106744 CGGACTGTCTTCACAGAGGAAGG - Intronic
966201042 3:177359764-177359786 CAGAGTGGGGTCACAAAGGGGGG - Intergenic
967482029 3:189983753-189983775 TAGAGTCTCATCACAAAGGAAGG - Intronic
968134536 3:196211441-196211463 CAGTGTGACATCACAGAGGCTGG + Intergenic
969316204 4:6382833-6382855 CAGACTGGCAGCAGAGAGGCTGG + Intronic
969576823 4:8040918-8040940 CAGAGTGGCATCAGCGACGTGGG + Intronic
970191896 4:13525269-13525291 CAGAGTAGCCTCAGAGAGGGAGG + Intergenic
971812928 4:31451127-31451149 CACAGTAGCATCACAGATTAGGG - Intergenic
973141057 4:46768398-46768420 CAGAGTAGCACGGCAGAGGAGGG - Intronic
974125373 4:57689886-57689908 CAGTGTTGCTTCACAGAGGTAGG + Intergenic
977537501 4:98272036-98272058 CAGTGTGGCATCACCTGGGAAGG - Intronic
979707797 4:123741183-123741205 CAAAGTGACATTACAGAGGATGG + Intergenic
982065689 4:151652678-151652700 GGGAATGGCCTCACAGAGGAGGG + Intronic
982125215 4:152178255-152178277 CAGTGTGTCTTCACAGTGGAGGG - Intergenic
985214207 4:187632856-187632878 CACAGTAGCATCACAGAGTTTGG + Intergenic
985949786 5:3214557-3214579 CCCTGTGGCATCATAGAGGAAGG - Intergenic
986598368 5:9446554-9446576 CAGAGTGGAAGCCCAGAGGCCGG - Intronic
986929121 5:12795744-12795766 CAGAGCCCCATCACAGAGGTTGG + Intergenic
988776502 5:34482173-34482195 CAGAGTGGCACAGCAGAGAAGGG + Intergenic
989111742 5:37913351-37913373 CAGGGAGGCCTCACGGAGGAGGG + Intergenic
989216339 5:38908096-38908118 CACAGTGGCAGCACAGGGGTAGG - Intronic
991004179 5:61811677-61811699 CAGGGTGGCAAGCCAGAGGAGGG + Intergenic
992091194 5:73318666-73318688 AAAAGTGACATCATAGAGGATGG - Intergenic
992146996 5:73860589-73860611 CAGAGTGGCAACAGTGAGAAGGG - Intronic
992994466 5:82318706-82318728 AAGATTGGCAACACAGAGAAGGG + Exonic
993096474 5:83484779-83484801 CAGAGTGACATCATAGAGAGTGG + Intronic
994727549 5:103454254-103454276 CAGAATGTGATCACAGAGGAAGG - Intergenic
995570264 5:113472293-113472315 CAGAATGGCCACACAGAAGATGG - Intronic
996741164 5:126800346-126800368 CAGGGAAGCATTACAGAGGAAGG + Intronic
997992481 5:138556993-138557015 CAGAGTGGCATGAAAGAGTCTGG + Intronic
998094089 5:139387654-139387676 CAGGATGGCAGCACAGAGCAAGG + Exonic
998136166 5:139675882-139675904 CAGAGTGGCAACACAGGTGGTGG + Intronic
998493725 5:142568754-142568776 CAGTGTTGCACCTCAGAGGAAGG + Intergenic
998520665 5:142797664-142797686 TAGAATGGAATCACAGACGAGGG - Intronic
999018633 5:148138098-148138120 CAGAGTTTCAGCATAGAGGAAGG - Intergenic
1002310959 5:178313505-178313527 CACTGTGGAGTCACAGAGGATGG + Intronic
1004590116 6:17042668-17042690 CATAGAGAAATCACAGAGGAGGG - Intergenic
1004737410 6:18421581-18421603 CAGGGTGGCACCACAGACCAAGG + Intronic
1006021287 6:31119227-31119249 AACAGGGACATCACAGAGGATGG - Intronic
1006879997 6:37331201-37331223 CAGACTGCCATCAGAGATGAAGG - Exonic
1007703405 6:43777380-43777402 AAGAGTGGCATTACAGAGCTGGG + Intronic
1010116435 6:72317047-72317069 CACAGAGGCCTCTCAGAGGAGGG + Intronic
1011691783 6:89876992-89877014 CAGAGTGGTATAACAGAGATTGG + Intergenic
1012171813 6:96025586-96025608 CAGAGAGGAATCAGAGAGCAGGG + Intronic
1012448996 6:99335091-99335113 TACAGTGGAAGCACAGAGGAAGG - Intronic
1013947486 6:115738372-115738394 CAAAATGGGATCACAGAAGAAGG - Intergenic
1014705650 6:124743073-124743095 CACTGTGGCATCACAGAGGCAGG + Intronic
1015747008 6:136520875-136520897 AAGAGTGGCAGGAAAGAGGATGG + Intronic
1016479535 6:144467296-144467318 CACAGTCGAATCACAGAGGAGGG - Intronic
1017087182 6:150724398-150724420 CTGAGTGGTAACACAGTGGATGG + Intronic
1017953676 6:159160320-159160342 CAGAGAGGCATCACAGGCCAGGG + Intergenic
1018614700 6:165676195-165676217 CAGAGTGGAATCACAGACTTTGG + Intronic
1018709764 6:166489926-166489948 CCGAGTGGCCTCACTTAGGAAGG + Intronic
1019618442 7:1977782-1977804 CAGAGTGCCATCTCAGAGAGCGG + Intronic
1019663550 7:2239732-2239754 CAGGTTGGCATCACACAGAACGG + Intronic
1020386505 7:7610284-7610306 CAGACAGGCATCAGAGAGGTAGG + Intergenic
1021089452 7:16465816-16465838 CAGAGTGAAAACACAGAGAAGGG + Exonic
1022280229 7:28900661-28900683 CACTGGGGCATCACTGAGGAAGG - Intergenic
1023364070 7:39445567-39445589 CAGAGAGGCTTTACAGAGGAGGG - Intronic
1023464264 7:40436279-40436301 CAGAGTTTCATCCCAGAGTATGG - Intronic
1023826213 7:44011576-44011598 CAGAATTGCATCACATAGGCTGG - Intergenic
1024233555 7:47380884-47380906 GACAGTGGCATGCCAGAGGAGGG + Intronic
1024378717 7:48669504-48669526 AAGTGTTGCATCACAAAGGATGG + Intergenic
1026089793 7:67290449-67290471 CAGAATTGCATCACATAGGCTGG - Intergenic
1026236250 7:68529567-68529589 CAGAGTAGCAGCTCAGAGGCAGG - Intergenic
1026724502 7:72860067-72860089 CAGAATTGCATCACACAGGCTGG + Intergenic
1027119385 7:75505761-75505783 CAGAATTGCATCACATAGGCTGG - Intergenic
1027251552 7:76401748-76401770 CAGGATGGCTTCCCAGAGGAAGG - Intronic
1027272444 7:76529847-76529869 CAGAATTGCATCACATAGGCTGG + Intergenic
1027325897 7:77048920-77048942 CAGAATTGCATCACATAGGCTGG + Intergenic
1029577433 7:101412691-101412713 CAGAGTAGCAGCTCAGAGGCAGG - Intronic
1029718111 7:102344271-102344293 CAGAATTGCATCACATAGGCTGG + Intergenic
1029754504 7:102564985-102565007 CAGAATTGCATCACATAGGCTGG - Intronic
1029772454 7:102664068-102664090 CAGAATTGCATCACATAGGCTGG - Intronic
1032576820 7:133063320-133063342 TAGAGTGGCAGGGCAGAGGAGGG - Intronic
1032732691 7:134659533-134659555 CAGGGTGGCAGAACAGAGAAGGG - Intronic
1033467126 7:141603706-141603728 CATAGTGGCATGGCTGAGGAAGG + Intronic
1033815604 7:145068951-145068973 CTGAGTGGGATAACACAGGAAGG - Intergenic
1035250232 7:157592538-157592560 CCGAGAGGCTTCACACAGGACGG + Intronic
1035400044 7:158558797-158558819 CTGAGTGGCACCCCAGAGGAAGG - Intronic
1035840614 8:2809063-2809085 CAGAATGGGACCACAGTGGAGGG - Intergenic
1037203128 8:16282295-16282317 CAGAGTGGCATCACAGAGGAAGG - Intronic
1037530685 8:19769857-19769879 CAGAGTAGCAGCCCAGAGGCAGG - Intergenic
1037828471 8:22174286-22174308 AACAGTGTGATCACAGAGGAGGG - Intronic
1039934890 8:42033651-42033673 CACTGTGGAAACACAGAGGAGGG - Intronic
1041159013 8:55018359-55018381 CAGAGTGATATCAGAGAAGAAGG + Intergenic
1041388482 8:57328804-57328826 CAGAGTGCCATCACTCAGAATGG - Intergenic
1044212528 8:89566519-89566541 CTGAGTTGCATTACAGAAGAAGG - Intergenic
1044426908 8:92062633-92062655 ATGAGTGGCAGCAGAGAGGAGGG + Intronic
1044457943 8:92410964-92410986 CAGAGGGGCCTCACAGAGCCTGG + Intergenic
1046232956 8:111381494-111381516 CAGAGTGGTATAACAGAGTTTGG - Intergenic
1046343359 8:112888549-112888571 CAGAGTGGTAGCACATTGGATGG - Intronic
1047749343 8:127867979-127868001 GACAGAGGGATCACAGAGGAAGG - Intergenic
1048276529 8:133070212-133070234 CAGTGTGACATCTCTGAGGACGG + Intronic
1048303210 8:133266390-133266412 CCGTGTGGCAGCAGAGAGGAAGG + Intronic
1049619175 8:143590116-143590138 CAGAGTTGCAACACAGCGGGTGG + Intronic
1051250192 9:15151487-15151509 CAGAATGGTTTCACAGAGCAAGG - Intergenic
1055971054 9:81913380-81913402 CAGACCTGCATCACAGAGCATGG - Intergenic
1056834633 9:89944599-89944621 AAGAATGACATCACAGGGGAGGG + Intergenic
1057860942 9:98640458-98640480 CAGAGTGGTTTCATGGAGGAAGG - Intronic
1059403528 9:114085688-114085710 CCCAGTGGGACCACAGAGGAAGG - Intergenic
1059677501 9:116553427-116553449 AACAGTGACATAACAGAGGAAGG - Intronic
1060180458 9:121530037-121530059 CAGAGAGGAATCTTAGAGGAGGG + Intergenic
1060874242 9:127068781-127068803 CAGAGTAGCAGCTCAGAGGCAGG + Intronic
1062002296 9:134222428-134222450 GACAGTGGCAGCACAGAGGCTGG - Intergenic
1062005449 9:134236459-134236481 CAGAGTGGCAGCACAAAGCCTGG - Intergenic
1062078732 9:134607245-134607267 CAGAGTAGCAGCTCAGAGGCAGG + Intergenic
1062085984 9:134648725-134648747 CAGTGTGACACCACACAGGATGG - Intronic
1062682233 9:137788109-137788131 CACAGAGGCCTCTCAGAGGAGGG + Intronic
1187480739 X:19652909-19652931 TAGACTGGCATCAAAGAGGAAGG - Intronic
1187798080 X:23026528-23026550 CAGGATTGCATCACAGAAGAGGG + Intergenic
1188245111 X:27829840-27829862 CAGACTGGCAGCACAGTGGCTGG + Intergenic
1189008356 X:37018677-37018699 CAGAATGGCATCAGAAAGGCAGG - Intergenic
1190375125 X:49781882-49781904 TAGAGTGGCATGTCAGGGGAGGG - Intergenic
1192759575 X:74082320-74082342 CAGAGTGGAATAACAGACGTTGG - Intergenic
1194988477 X:100518263-100518285 CACAGTGGCATCACAGCCCAGGG - Intergenic
1195362939 X:104102836-104102858 GAAAGGGGCATCACAGAGGCTGG + Exonic
1200023845 X:153238099-153238121 CAGTGTGACAGCACAGTGGAGGG + Intergenic
1201303651 Y:12532196-12532218 CAGTGTGGACTCAGAGAGGAAGG + Intergenic
1201751514 Y:17436771-17436793 AAGAGTGGCATAGCAGAGGAGGG - Intergenic