ID: 1037203803

View in Genome Browser
Species Human (GRCh38)
Location 8:16290192-16290214
Sequence CTGGAACTGGACTGTTTTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037203796_1037203803 13 Left 1037203796 8:16290156-16290178 CCAACACACATAGGGTGACCAAT 0: 1
1: 0
2: 0
3: 4
4: 77
Right 1037203803 8:16290192-16290214 CTGGAACTGGACTGTTTTGTAGG No data
1037203799_1037203803 -5 Left 1037203799 8:16290174-16290196 CCAATGGTCCTGTTTTGCCTGGA 0: 1
1: 1
2: 8
3: 33
4: 170
Right 1037203803 8:16290192-16290214 CTGGAACTGGACTGTTTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037203803 Original CRISPR CTGGAACTGGACTGTTTTGT AGG Intronic
No off target data available for this crispr