ID: 1037205011

View in Genome Browser
Species Human (GRCh38)
Location 8:16306532-16306554
Sequence CATGAGCAGCAGACAGTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 229}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037205011 Original CRISPR CATGAGCAGCAGACAGTGCA AGG (reversed) Intronic
901020530 1:6252974-6252996 CAGGATCAGGAGACAGAGCAAGG - Intronic
903009550 1:20320081-20320103 CATGAGCGGGAGGCAGAGCATGG - Intronic
904091685 1:27949396-27949418 CAGGAGCAGAAGTCAGTGAAAGG - Intronic
908116225 1:60943041-60943063 CATGAGAGGAAGACACTGCATGG + Intronic
911959529 1:104283008-104283030 CAGGAGCAGCAGGCAGTACCAGG - Intergenic
912259212 1:108092565-108092587 CATGAGCAGCTGAGATTGAAAGG - Intergenic
912725309 1:112054044-112054066 CCTGTGCAGCAGACAGAGCTAGG - Intergenic
914363007 1:146952272-146952294 AATGAGCAGCTGACAGTGGCTGG + Intronic
914488672 1:148134867-148134889 AATGAGCAGCCGACAGTGGCTGG - Intronic
917150804 1:171942809-171942831 CAGAAGCAGGAGCCAGTGCAAGG + Intronic
917224617 1:172768277-172768299 CATGTCCAGTAGACAGTCCATGG + Intergenic
919879137 1:201890641-201890663 AATGGGCAGCAGAGAGTTCATGG + Intronic
919883160 1:201914260-201914282 CAGGGGCTGCAGACAGTGGACGG - Intronic
920682723 1:208084956-208084978 CATCGGCATCAGACAATGCAAGG - Intronic
920974113 1:210769645-210769667 AATTAACAGCAGTCAGTGCATGG - Intronic
921345870 1:214184653-214184675 AATGAGAAGCAGCCAGTCCACGG - Intergenic
922362063 1:224832081-224832103 CATGAGCAAAAGAGAATGCAGGG + Intergenic
924611635 1:245578294-245578316 CATGAGCCTCATACAGTGAATGG + Intronic
1063086032 10:2818429-2818451 CATCAGCAGCACCCTGTGCATGG + Intergenic
1063442161 10:6081543-6081565 CATGAGCTGCAGAGAGTGGGAGG + Intergenic
1064016076 10:11773291-11773313 CCTGAACAGCAGACATTGGATGG - Intergenic
1065903875 10:30231229-30231251 CATGAGCAGCACACAGGGGAGGG - Intergenic
1067966152 10:50915143-50915165 CATGAGATGCAGACATTGCTTGG + Intergenic
1071295894 10:84219389-84219411 GAAGAGCAGCAAGCAGTGCAGGG - Intronic
1072155874 10:92723204-92723226 CATGAGCAGCCCACTGTGAAGGG + Intergenic
1074438039 10:113451260-113451282 TCTGATCAGCAGGCAGTGCATGG + Intergenic
1075266138 10:121000842-121000864 CAGCAGCAGAAGGCAGTGCAGGG - Intergenic
1077572308 11:3350261-3350283 TCTGGCCAGCAGACAGTGCACGG + Intronic
1077795455 11:5486735-5486757 CATGGGCATCAGCCAGTGCAGGG - Intronic
1078528211 11:12116752-12116774 CATGAGCAGCTGACAGAGAAGGG - Intronic
1078572233 11:12469227-12469249 CATGAGCAGAAGAAAGTACCTGG - Intronic
1079118320 11:17655183-17655205 CGTGGGCAACAGGCAGTGCAAGG + Intergenic
1079759575 11:24311289-24311311 CAGGAGAGACAGACAGTGCAGGG - Intergenic
1080196427 11:29614883-29614905 AATGAGAAGCAGACAGTCCTAGG - Intergenic
1083487768 11:62994410-62994432 CCTGAGCCCCAGAGAGTGCAGGG + Intronic
1085279282 11:75319751-75319773 CAGGAGGAGCAGACAGGGAAAGG + Intronic
1085310676 11:75514809-75514831 CATGAACAGCATACAGAGAAGGG + Intronic
1087891887 11:103544954-103544976 CATGAAGTGCAGATAGTGCATGG - Intergenic
1089002885 11:115067040-115067062 CCTCAGGAGCAGACAGTGTACGG - Intergenic
1089094353 11:115906478-115906500 CATGAGGAGCAGAGACTGAAGGG - Intergenic
1089515187 11:119027692-119027714 GATGAGCAGGAGACAGAGGAAGG + Exonic
1091383790 12:79082-79104 CATGAGGAGCAGGAAGTGCCAGG - Intronic
1092087214 12:5773013-5773035 CATGAGCAGGAGTCAGCGGATGG + Intronic
1092254943 12:6921722-6921744 CTTGAGCAGCAGACAGTTGCAGG - Exonic
1096322682 12:50629201-50629223 CAGGAGCAGCAGGAAGTGAAGGG - Intronic
1096570977 12:52522964-52522986 TGTCAGCAGAAGACAGTGCAGGG + Intergenic
1096596954 12:52701880-52701902 CAGGAGAAGCAGGCAGGGCATGG - Intronic
1096695054 12:53343750-53343772 GATGAGCAGAAGTCAGTGGAGGG + Intronic
1098096410 12:66961302-66961324 AATGAGCAACAAACAGTGCTAGG + Intergenic
1098451186 12:70619667-70619689 CATGACTAGCAGTCAGTGCTGGG - Intronic
1100794686 12:98168963-98168985 ATTGAACAGCAGACAGTGCAGGG + Intergenic
1102389683 12:112539531-112539553 CATGGGCATCAGACAGTCCTGGG + Intergenic
1103638764 12:122331294-122331316 CATGAGCTACATACAGTGCCTGG + Intronic
1104247242 12:127055688-127055710 CAGCAGCAGCAGGCACTGCAGGG - Intergenic
1104288388 12:127446451-127446473 CCTGTGCACCAGAGAGTGCAAGG + Intergenic
1104612590 12:130241480-130241502 CAGGAGCTGCAGACAGCCCAGGG + Intergenic
1105029891 12:132874831-132874853 CAGGACCAGCACCCAGTGCAGGG + Intronic
1107800660 13:44105173-44105195 CTTGAGCAGCACACACTGCAGGG + Intergenic
1113866200 13:113526987-113527009 CAGGAGCAGGAGGCAGTGCCAGG + Intronic
1114987884 14:28252597-28252619 CATAAGCAGCAGCCAGGGAATGG - Intergenic
1118563711 14:67116169-67116191 CCTGAGTAGCAGACACTACAGGG - Intronic
1121150452 14:91628616-91628638 CAGGAGAAAGAGACAGTGCAGGG - Intronic
1122340460 14:101024886-101024908 CATCTGCGGCAGACATTGCATGG + Intergenic
1122740417 14:103868788-103868810 CATGAGCAAGAGCCAGTGCTGGG + Intergenic
1126402827 15:48292144-48292166 CAAGAGCAGCACGAAGTGCAAGG + Intronic
1130241384 15:82196128-82196150 CAGAAGAAGCAGACAGTGAAGGG + Intronic
1132229509 15:100171221-100171243 TCTGGGCAGCAGACAGTGCAAGG + Intronic
1132810275 16:1793835-1793857 CCTGGGGTGCAGACAGTGCAGGG + Intronic
1132892123 16:2209642-2209664 CAGGAGCTGCTGGCAGTGCAGGG - Exonic
1136111668 16:28067361-28067383 CATGAGCTGAAGACAGTGGATGG + Intergenic
1138549825 16:57741511-57741533 CAGGACCAGCAGACAGGGCAGGG - Intronic
1138654835 16:58485276-58485298 CATGAAAAACAGACAGTCCAGGG - Intronic
1140995755 16:80258230-80258252 CATGGACAGCAGACACTGGAGGG + Intergenic
1142139108 16:88464711-88464733 CCGGACCAGGAGACAGTGCAGGG - Intronic
1143577732 17:7804452-7804474 GATGAGCAGCAGAAGGTCCAGGG + Exonic
1143787838 17:9269492-9269514 CACTAGCAGCAGACATTGGAAGG - Intronic
1144753652 17:17666967-17666989 CATGAGCCGCAGACACTCCGTGG + Intergenic
1147198917 17:38786384-38786406 TATGAGCAACAGGCAGAGCATGG - Intronic
1148448625 17:47757994-47758016 CATGAGAAGCAAACAGGGCTTGG - Intergenic
1149089224 17:52758358-52758380 CATGAACAACACACAGTACAGGG - Intergenic
1150342894 17:64383205-64383227 CTAGACCAGCAGACAGTGCTGGG + Intronic
1151513605 17:74578115-74578137 CCTGGGCAGCAGACAGGACATGG + Intergenic
1151904572 17:77039296-77039318 CAGGGACAGGAGACAGTGCAGGG + Intergenic
1153006473 18:501912-501934 CATCAACTGCAGACAGTGCGGGG - Intergenic
1153524042 18:5978252-5978274 CACGAGCAGCAGATAGTCCTGGG + Intronic
1157339363 18:46765694-46765716 CATGGTCAGCAGACAGTCCTGGG - Intergenic
1157703577 18:49781418-49781440 CATGAACAGAAGTCAGTTCAAGG + Intergenic
1158849300 18:61478632-61478654 CATGAGGAGTAAACAGTGGATGG + Intronic
1159891757 18:73959474-73959496 CATGAGCAGCAGAAAATCGAGGG + Intergenic
1160071981 18:75636977-75636999 AGTGAGCAGCACACAGTGCACGG + Intergenic
1160450954 18:78965618-78965640 TTTGAGAAGCAGACAGTGCGGGG - Intergenic
1161145411 19:2675291-2675313 CAGGAACAGCAGCAAGTGCACGG + Intronic
1161470725 19:4455703-4455725 CAGAAGGTGCAGACAGTGCAGGG - Intronic
1162452796 19:10764863-10764885 GGTGAGCAGCAGACAGTGGCAGG - Intronic
1162570867 19:11471923-11471945 AATCAGCAGCAAACAGTGCTGGG + Intronic
1163662801 19:18588834-18588856 CCTCAGCAGCAGGCACTGCAGGG - Exonic
1164445086 19:28310128-28310150 CATGTGAAGCACACAGGGCAAGG + Intergenic
1164764806 19:30756233-30756255 GCTGAGCAGGAGACAATGCATGG + Intergenic
1166774544 19:45304409-45304431 CATGAGCAGGAGAAAAGGCATGG + Intronic
925427411 2:3762230-3762252 CAGGAGCAGGACAAAGTGCATGG - Intronic
927177577 2:20421473-20421495 CATGAGCTGGAGGCAGTGAAAGG + Intergenic
928395576 2:30941070-30941092 CAATGGCAGCAGACAATGCATGG + Intronic
928628196 2:33162865-33162887 CAAGGCCAGCAGACATTGCACGG + Intronic
929312253 2:40438898-40438920 CAGGAACAGCACACAGGGCATGG + Intronic
929754217 2:44750445-44750467 CAGGGACAGCAGACAGGGCACGG - Intronic
932224054 2:70024986-70025008 TTTGAGCTACAGACAGTGCAAGG - Intergenic
935685557 2:105679674-105679696 CATGGGCAGGAGACAGAGAAGGG - Intergenic
936115549 2:109699954-109699976 ACTGAGCAACAGGCAGTGCAAGG - Intergenic
937678660 2:124620032-124620054 CATGAGCAGAACACAGAGTAGGG - Intronic
937990956 2:127662079-127662101 CCTGAGCAGCAGTCAGACCAAGG + Intronic
938139938 2:128787154-128787176 CATCAACACCAGACAGTCCATGG - Intergenic
938703437 2:133899423-133899445 CCTGAGGGGCAGACATTGCAGGG - Intergenic
939669296 2:144990073-144990095 CATCAGCAGGAGGCAGTTCAAGG + Intergenic
940867233 2:158829558-158829580 TTTGGGCAGCAGACACTGCAGGG + Intronic
941654646 2:168130165-168130187 CAAGAGCAGCAGGTACTGCAAGG + Intronic
941657574 2:168160393-168160415 CATGATCTCCAGTCAGTGCAAGG + Intronic
946405030 2:219487947-219487969 CATTGTCAGCAGTCAGTGCAAGG + Intronic
947764118 2:232624874-232624896 CATGACCAGCAGAAAGTGAGGGG - Intronic
947904197 2:233747884-233747906 CATAAGGAGCAGAAAGAGCATGG - Intronic
948861537 2:240755015-240755037 CAGGAGCTGCAGAGAGAGCAGGG - Intronic
1170127351 20:12979132-12979154 CATGAGTTACACACAGTGCAAGG - Intergenic
1171183944 20:23111578-23111600 CCTGAGCAGCAGCCCGTGCAGGG - Intergenic
1171278260 20:23876531-23876553 TATGAGGAGCAGCCTGTGCAAGG + Intronic
1173362157 20:42354580-42354602 CTCCAGCAGCACACAGTGCAGGG - Intronic
1174130806 20:48342153-48342175 CTGGAGGAGCAGACAGTGCAGGG - Intergenic
1174146426 20:48455601-48455623 CATGAGCAGCAGGCACTCCCTGG + Intergenic
1174423698 20:50417184-50417206 CTTGAGCAGCAGCCTGTGCCGGG + Intergenic
1175817134 20:61889088-61889110 CATGAGCTGCAGGCACAGCAGGG - Intronic
1179051050 21:37888873-37888895 CCTAAGCAGCAGACAGAGCCGGG + Intronic
1179988805 21:44935204-44935226 CAGGAGCAGGAGACAGTCCAGGG + Intronic
1181324057 22:22031279-22031301 CATCAGCAGCAGCCAGAGAAGGG + Intergenic
1181844174 22:25693287-25693309 CCTCAGCAGCAGGCAGTCCAAGG + Intronic
1181864105 22:25841649-25841671 CATGTCCAGCAGAGAGTGCTAGG + Intronic
1182251261 22:29002723-29002745 CAGCAGCAACAGGCAGTGCAGGG + Intronic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1184129032 22:42506372-42506394 CCTGTGCAGCAGCCAGTGCCTGG - Intergenic
1184138979 22:42566686-42566708 CCTGTGCAGCAGCCAGTGCCTGG - Intronic
1184249119 22:43250272-43250294 CTTGATCAGCAGACACTGCCTGG - Intronic
1185393802 22:50576835-50576857 TGTGAGCAGCAGCCAGTGGAGGG - Exonic
949695751 3:6693032-6693054 TATGGACATCAGACAGTGCAGGG + Intergenic
950011806 3:9729453-9729475 CATGACCAGGAGAGAGGGCATGG - Intronic
953478459 3:43227005-43227027 CATGAGGAGCTCACAGTGTAGGG + Intergenic
954297624 3:49682960-49682982 GATGGGCAGCACACAGGGCAAGG - Intronic
954913438 3:54128641-54128663 CATGAGCAGCAGCTACTTCAGGG + Intronic
956465064 3:69511818-69511840 CCTGTGCAGGATACAGTGCAGGG - Intronic
960882157 3:122356047-122356069 GGTGAGCAGGAGACAGAGCATGG + Intergenic
960953232 3:123012992-123013014 CATGAGGAGGAGACAGTGTAAGG + Intronic
961127602 3:124434437-124434459 CATGAGCTGCTGCCAGTGGAGGG - Exonic
962898629 3:139737646-139737668 CATGTGAAGCAGAGAGAGCAGGG + Intergenic
964707456 3:159634643-159634665 CATCAGCCACACACAGTGCAGGG - Intronic
965145766 3:164900909-164900931 CTTGAGCACCAGACACAGCACGG + Intergenic
966200465 3:177356039-177356061 CAGGAGCAAGAGAGAGTGCAGGG + Intergenic
967921733 3:194619130-194619152 CCTGAGCAGCAGCAAGAGCAAGG - Intronic
968189115 3:196654664-196654686 CAGGAGCAGCCGACAGATCAGGG - Intronic
968270079 3:197396721-197396743 AATGGGCAGAAGAGAGTGCAGGG + Intergenic
968385890 4:137083-137105 CAGGAGCAAGAGACAGTGAAAGG - Intronic
968607188 4:1541101-1541123 AGAGAGCAGCAGACAGAGCAGGG + Intergenic
970257261 4:14181456-14181478 CAAGACTGGCAGACAGTGCAAGG + Intergenic
970420442 4:15901092-15901114 AAGAAGCAGCAGACACTGCATGG - Intergenic
971344815 4:25802290-25802312 CTTGACCAGCACACACTGCAAGG - Exonic
973645835 4:52950599-52950621 CATGAGCCACGGGCAGTGCAGGG - Intronic
974472767 4:62339402-62339424 CATGTTCAGCAGACAGTGAGGGG - Intergenic
975450510 4:74519862-74519884 CAGGAGCAAGAGAGAGTGCAGGG - Intergenic
977922527 4:102661084-102661106 AATGAGCAGCAAGCAGTGCCTGG - Intronic
979524544 4:121703475-121703497 CATGAGCACCAGGCCGGGCAGGG + Intergenic
982351112 4:154416366-154416388 CATTAGCAGCTGACAGCGCAGGG + Intronic
982559322 4:156910276-156910298 CATTAGCAGAAGAGAGTGAAGGG - Intronic
983207794 4:164929690-164929712 CATGAGCGGCTGACAGGGCACGG + Intergenic
983702572 4:170615674-170615696 CATGAGGAGCAGGCAAAGCAGGG - Intergenic
985580688 5:693831-693853 AAGGAGCCGCAGACGGTGCAGGG + Intergenic
985595311 5:785163-785185 AAGGAGCCGCAGACGGTGCAGGG + Intergenic
985731031 5:1549024-1549046 CAGGAGCAGCTGAGCGTGCAGGG + Intergenic
987046331 5:14112678-14112700 AATGAGCAGCAGACCATCCAAGG + Intergenic
987749238 5:22018466-22018488 TATGTGCAGCACACAGTGAATGG - Intronic
988799900 5:34686775-34686797 CATGGGAAGGAGACAGAGCAGGG - Intronic
989532151 5:42520465-42520487 AATGAATGGCAGACAGTGCAGGG - Intronic
990318971 5:54611359-54611381 CATGTTCAGGAGACAGGGCATGG - Intergenic
992457169 5:76926497-76926519 CCTGAGGAGCAGCCAGTCCAGGG - Intergenic
995528642 5:113071490-113071512 CATGAGCAGGGCACAGTGCTAGG + Intronic
996001036 5:118363703-118363725 CTTGAGCATCTGAGAGTGCAAGG + Intergenic
997243858 5:132329443-132329465 AATGAGCAGAACACAGTGCCTGG - Intronic
998295654 5:140966822-140966844 CAGTAGCAGCAGCCAGGGCATGG - Exonic
999737828 5:154526086-154526108 CCTTTGCAGTAGACAGTGCATGG + Intergenic
1002206890 5:177569146-177569168 CCTGAGTTGCAGACAGTGCAGGG - Intergenic
1002332182 5:178450850-178450872 CATGAACTGCAGACAGAGCCAGG + Intronic
1004003373 6:11616212-11616234 CATGAGCCCCACAGAGTGCAGGG + Intergenic
1004705255 6:18118508-18118530 CAAAAGCAGGAGACAGTCCAAGG + Intergenic
1007320351 6:41024199-41024221 CATAAAGAGCAGGCAGTGCACGG + Intergenic
1007335820 6:41154256-41154278 CAGGAGCAGCAGCAAGAGCAGGG + Exonic
1008558337 6:52697554-52697576 CATGTGCAGAAGAAGGTGCAGGG - Intergenic
1008817480 6:55586307-55586329 CATGATGAAGAGACAGTGCAGGG + Intergenic
1010877065 6:81120015-81120037 CATCAGAAGCAGACATGGCAGGG - Intergenic
1014290387 6:119551364-119551386 CAAGAACAGCAGAAAGTCCATGG - Intergenic
1015413320 6:132919677-132919699 CCTGAGCAGCAGGCTGGGCAAGG - Intergenic
1017028876 6:150203656-150203678 CATGAGCAGTTGATAGTGCAGGG + Intronic
1019147789 6:169985990-169986012 TATGAGCAGAAGACAGGGCAGGG + Intergenic
1022819763 7:33948077-33948099 TTTGGGCAGCAGACAATGCATGG - Intronic
1024462889 7:49678298-49678320 CATCTGCAGCAGAAAGTGAATGG + Intergenic
1026254221 7:68696936-68696958 AATGAGGAGGAGACAGGGCATGG - Intergenic
1027419406 7:78004976-78004998 CATGAGGAGGAGAAAGTCCAGGG + Intergenic
1028320310 7:89451256-89451278 AATGAGCAGCATACAGTTTAGGG - Intergenic
1028357377 7:89925729-89925751 CCTGAGCAGCTCACAGTGTAGGG - Intergenic
1029495553 7:100894203-100894225 CGTGTGCAGCAGACACTGCGGGG + Exonic
1030065421 7:105655548-105655570 AAGGAGCCGCAGACACTGCAAGG - Intronic
1030346728 7:108442201-108442223 GATGTGCAGCTGTCAGTGCAGGG + Intronic
1030615927 7:111738270-111738292 CATGAGCAGTTGACAGGGAAAGG + Intronic
1032163298 7:129526824-129526846 CAGGAGCAGCAGCCACTCCAGGG - Intergenic
1032359994 7:131246233-131246255 CATCAGCAGCCGACAAGGCAGGG - Intronic
1032662384 7:133999116-133999138 CATCAGGATCAGAAAGTGCATGG + Intronic
1032871647 7:135992049-135992071 CCTGCCCAGCAGACATTGCAAGG - Intergenic
1035870739 8:3133759-3133781 CATGAGCAGTGGTCAGTTCATGG - Intronic
1036103322 8:5811836-5811858 CATATTCAGCAGACAGTGCAAGG + Intergenic
1036820921 8:11938723-11938745 AATGAGCAGCACACAATGAAAGG + Intergenic
1037205011 8:16306532-16306554 CATGAGCAGCAGACAGTGCAAGG - Intronic
1037563097 8:20092391-20092413 GATGAGCAGGAGAAGGTGCATGG - Intergenic
1037807805 8:22068080-22068102 AAGGTGCAGGAGACAGTGCAAGG + Intronic
1042329670 8:67565502-67565524 CATGCACCTCAGACAGTGCAAGG - Intronic
1043992516 8:86773512-86773534 CATGAGAAGCCCAAAGTGCAGGG - Intergenic
1044869371 8:96603528-96603550 CTTTAGCAGCAGACAGGGTATGG + Intronic
1044944089 8:97374974-97374996 CAAGAGCAGGAGGCAGTGCCAGG + Intergenic
1045062144 8:98419708-98419730 CATCAGCAGCAGAGAATGCCAGG + Intronic
1045472948 8:102528693-102528715 CACGCGCAGCACACAGCGCACGG - Intergenic
1046387085 8:113519396-113519418 CATGAGGAGCTGACAGAGCTGGG - Intergenic
1046581906 8:116103391-116103413 CATCAGCAGCAAACACAGCAAGG + Intergenic
1049387306 8:142349832-142349854 CATGAGCAGCAGGGTGGGCAGGG + Intronic
1049710751 8:144062284-144062306 CATGAGCAGCAGCCCATCCATGG - Intronic
1051378589 9:16431555-16431577 CCTCAGCAGCAGACAGATCAAGG + Intronic
1052268735 9:26604466-26604488 CCTCAGAAACAGACAGTGCAAGG + Intergenic
1054293118 9:63315863-63315885 CCAGAGCAGGAGACAGAGCAGGG - Intergenic
1055068676 9:72145079-72145101 CATGAGGTACAGAGAGTGCAGGG - Intronic
1055606202 9:77973315-77973337 CATGTGCAGCAGTAAGGGCAGGG + Intronic
1055906222 9:81296076-81296098 CATCAGAACCAGACAGTGTAGGG + Intergenic
1056555482 9:87684096-87684118 CATCAGCATCAGACAGCGCCCGG + Intronic
1057479686 9:95434740-95434762 CATGAGAAGCAGACTGTGAGAGG - Intergenic
1058732089 9:107860115-107860137 CATCACCAGCAGAGAGGGCAAGG + Intergenic
1058835303 9:108854808-108854830 CAGGAGCGGCAGCCACTGCAGGG + Exonic
1061959825 9:133982296-133982318 CAGGAGCACCAAACTGTGCATGG + Intronic
1062093115 9:134688955-134688977 CATGACCAGCTGACAGTGCAGGG - Intronic
1186886957 X:13923292-13923314 CATCATCAGCAGACAGGGAATGG + Intronic
1187358787 X:18604670-18604692 CGTGAGGTGCAGACAGTGAATGG - Exonic
1189716039 X:43867153-43867175 CATTTGTAGCAGACATTGCAGGG - Intronic
1190264435 X:48819066-48819088 CATGTGCATCTGACTGTGCATGG + Intronic
1190341794 X:49303012-49303034 CCACAGCAGCAGAAAGTGCAGGG - Intergenic
1190357198 X:49616966-49616988 GGTGAGCAGCAGACTGTGAATGG + Intergenic
1192313878 X:70037132-70037154 CAAGAGGAGCAGACTGTACAAGG - Exonic
1194864546 X:99049545-99049567 CATGAGCAGGAGAAAGGGAAGGG + Intergenic
1196687388 X:118523386-118523408 CATGTGCAGCAGGCAGTTCATGG + Intronic
1196745741 X:119070454-119070476 CATGAGAAGCAGGAAGTGCTGGG + Intergenic
1197417835 X:126196942-126196964 CAGGAGCAGGAGAGAGTGGAGGG - Intergenic
1199091935 X:143702734-143702756 CAAGAGCAAGAGAGAGTGCAGGG - Intergenic
1199720562 X:150540282-150540304 CAGGAGCAACAGAGAGAGCAGGG - Intergenic
1201902280 Y:19055965-19055987 CATCAACAGCAGACAGTCCATGG + Intergenic