ID: 1037209379

View in Genome Browser
Species Human (GRCh38)
Location 8:16367251-16367273
Sequence GTGAATACCCTGACATCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1140
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 1117}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037209379_1037209382 -3 Left 1037209379 8:16367251-16367273 CCCAAAGATGTCAGGGTATTCAC 0: 1
1: 0
2: 0
3: 22
4: 1117
Right 1037209382 8:16367271-16367293 CACCCAGGTAACCATGAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037209379 Original CRISPR GTGAATACCCTGACATCTTT GGG (reversed) Intronic
902730664 1:18366688-18366710 ATGAAAACCCTGTCATCTGTGGG + Intronic
906811949 1:48836128-48836150 GTGAATGCATTGAGATCTTTAGG + Intronic
908342298 1:63194059-63194081 CTGACTACCCTTACAGCTTTGGG - Intergenic
909116940 1:71549223-71549245 GTTAATTCCCTGAGATCTTAAGG - Intronic
910969549 1:92841961-92841983 GGAAATACCCTGAAATATTTTGG + Intronic
913733434 1:121743225-121743247 GTGGATATTCTGACATCTTGTGG + Intergenic
913733507 1:121744584-121744606 GTGGATATTCTGACATCTTGTGG + Intergenic
913733545 1:121745263-121745285 GTGGATATTCTGACATCTTGTGG + Intergenic
913733655 1:121747302-121747324 GTGGATATTCTGACATCTTGTGG + Intergenic
913733691 1:121747981-121748003 GTGGATATTCTGACATCTTGTGG + Intergenic
913733747 1:121749000-121749022 GTGGATATTCTGACATCTTGTGG + Intergenic
913733785 1:121749679-121749701 GTGGATATTCTGACATCTTGTGG + Intergenic
913735208 1:121774927-121774949 GTGGATATTCTGACATCTTGTGG + Intergenic
913735280 1:121776286-121776308 GTGGATATTCTGACATCTTGTGG + Intergenic
913789703 1:122503351-122503373 GTGGATATTCTGACATCTTGTGG + Intergenic
913790049 1:122509475-122509497 GTGGATATTCTGACATCTTGTGG + Intergenic
913790125 1:122510835-122510857 GTGCATAGTCTGACATCTTGTGG + Intergenic
913790202 1:122512194-122512216 GTGGATATTCTGACATCTTGTGG + Intergenic
913790297 1:122513894-122513916 GTGGATATTCAGACATCTTTGGG + Intergenic
913790423 1:122515935-122515957 GTGGATATTCTGACATCTTGTGG + Intergenic
913790854 1:122523758-122523780 GTGGATATTCTGACATCTTGTGG + Intergenic
913791212 1:122530220-122530242 GTGGATATTCTGACATCTTGTGG + Intergenic
913791290 1:122531581-122531603 GTGGATATTCTGACATCTTGTGG + Intergenic
913791439 1:122534300-122534322 GTGGATATTCTGACATCTTGTGG + Intergenic
913791851 1:122541779-122541801 GTGGATATTCTGACATCTTGTGG + Intergenic
913792608 1:122555719-122555741 GTGGATATTCTGACATCTTGTGG + Intergenic
913792684 1:122557078-122557100 GTGGATATTCTGACATCTTGTGG + Intergenic
913792765 1:122558439-122558461 GTGGATATTCTGACATCTTGTGG + Intergenic
913793248 1:122566941-122566963 GTGGATATTCTGACATCTTGTGG + Intergenic
913793321 1:122568303-122568325 GTGGATATTCTGACATCTTGTGG + Intergenic
913793394 1:122569663-122569685 GTGGATATTCTGACATCTTGTGG + Intergenic
913793464 1:122571022-122571044 GTGGATATTCTGACATCTTGTGG + Intergenic
913793534 1:122572383-122572405 GTGGATATTCTGACATCTTGTGG + Intergenic
913793890 1:122578505-122578527 GTGGATATTCTGACATCTTGTGG + Intergenic
913794116 1:122582583-122582605 GTGGATATTCTGACATCTTGTGG + Intergenic
913794495 1:122589385-122589407 GTGGATATTCTGACATCTTGTGG + Intergenic
913794708 1:122593125-122593147 GTGGATATTCTGACATCTTGTGG + Intergenic
913794997 1:122598230-122598252 GTGGATATTCTGACATCTTGTGG + Intergenic
913795073 1:122599590-122599612 GTGGATATTCTGACATCTTGTGG + Intergenic
913795107 1:122600269-122600291 GTGGATATTCTGACCTCTTTGGG + Intergenic
913795230 1:122602310-122602332 GTGGATATTCTGACATCTTCTGG + Intergenic
913795308 1:122603670-122603692 GTGGATATTCTGACATCTTGTGG + Intergenic
913795328 1:122604009-122604031 GTGGATATTCTGACATCTTCTGG + Intergenic
913795390 1:122605027-122605049 GTGGATATTCTGACATCTTGTGG + Intergenic
913795506 1:122607069-122607091 GTGGATATTCTGACATCTTGTGG + Intergenic
913795780 1:122611829-122611851 GTGGATATTCTGACATCTTGTGG + Intergenic
913795911 1:122614211-122614233 GTGGATATTCTGACATCTTGTGG + Intergenic
913796099 1:122617610-122617632 GTGGATATTCTGACATCTTGTGG + Intergenic
913796250 1:122620330-122620352 GTGGATATTCTGACATCTTGTGG + Intergenic
913796329 1:122621690-122621712 GTGGATATTCTGACATCTTGTGG + Intergenic
913796460 1:122624064-122624086 GTGGATATTCTGACATCTTGTGG + Intergenic
913796556 1:122625764-122625786 GTGGATATTCTGACATCTTGTGG + Intergenic
913796633 1:122627120-122627142 GTGGATATTCTGACATCTTGTGG + Intergenic
913797090 1:122635278-122635300 GTGGATATTCTGACATCTTGTGG + Intergenic
913797330 1:122639358-122639380 GTGGATATTCTGACATCTTGTGG + Intergenic
913798056 1:122652611-122652633 GTGGATATTCTGACATCTTGTGG + Intergenic
913798225 1:122655673-122655695 GTGGATATTCTGACATCTTGTGG + Intergenic
913798291 1:122656693-122656715 GTGGATATTCTGACATCTTGTGG + Intergenic
913798869 1:122667237-122667259 GTGGATATTCTGACATCTTGTGG + Intergenic
913798943 1:122668595-122668617 GTGGATATTCTGACATCTTGTGG + Intergenic
913799221 1:122673699-122673721 GTGGATATTCTGACATCTTGTGG + Intergenic
913799412 1:122677442-122677464 GTGGATATTCTGACATCTTGTGG + Intergenic
913799571 1:122680161-122680183 GTGGATATTCTGACATCTTGTGG + Intergenic
913799648 1:122681520-122681542 GTGGATATTCTGACATCTTGTGG + Intergenic
913800178 1:122691041-122691063 GTGGATATTCTGACATCTTGTGG + Intergenic
913800367 1:122694444-122694466 GTGGATATTCTGACATCTTGTGG + Intergenic
913800462 1:122696143-122696165 GTGGATATTCTGACATCTTGTGG + Intergenic
913800525 1:122697163-122697185 GTGGATATTCTGACATCTTGTGG + Intergenic
913800598 1:122698522-122698544 GTGGATATTCTGACATCTTGTGG + Intergenic
913800848 1:122702938-122702960 GTGGATATTCTGACATCTTGTGG + Intergenic
913800949 1:122704977-122704999 GTGGATATTCTGACATCTTGTGG + Intergenic
913801081 1:122707357-122707379 GTGGATATTCTGACATCTTGTGG + Intergenic
913801260 1:122710758-122710780 GTGGATATTCTGACATCTTGTGG + Intergenic
913801353 1:122712452-122712474 GTGGATATTCTGACATCTTGTGG + Intergenic
913801431 1:122713810-122713832 GTGGATATTCTGACATCTTGTGG + Intergenic
913801602 1:122716873-122716895 GTGGATATTCTGACATCTTGTGG + Intergenic
913801659 1:122717891-122717913 GTGGATATTCTGACATCTTGTGG + Intergenic
913801772 1:122719930-122719952 GTGGATATTCTGACATCTTGTGG + Intergenic
913801831 1:122720950-122720972 GTGGATATTCTGACATCTTGTGG + Intergenic
913801906 1:122722309-122722331 GTGGATATTCTGACATCTTGTGG + Intergenic
913801964 1:122723328-122723350 GTGGATATTCTGACATCTTGTGG + Intergenic
913802023 1:122724347-122724369 GTGGATATTCTGACATCTTGTGG + Intergenic
913802442 1:122731826-122731848 GTGGATATTCTGACATCTTGCGG + Intergenic
913802496 1:122732847-122732869 GTGGATATTCTGACATCTTGTGG + Intergenic
913802611 1:122734885-122734907 GTGGATATTCTGACATCTTGTGG + Intergenic
913802967 1:122741347-122741369 GTGGATATTCTGACATCTTGTGG + Intergenic
913803169 1:122745087-122745109 GTGGATATTCTGACATCTTGTGG + Intergenic
913803381 1:122748831-122748853 GTGGATATTCTGACATCTTGTGG + Intergenic
913803436 1:122749850-122749872 GTGGATATTCTGACATCTTGTGG + Intergenic
913803584 1:122752570-122752592 GTGGATATTCTGACATCTTGTGG + Intergenic
913803843 1:122757327-122757349 GTGGATATTCTGACATCTTGTGG + Intergenic
913803901 1:122758346-122758368 GTGGATATTCTGACATCTTGTGG + Intergenic
913803952 1:122759364-122759386 GTGGATATTCTGACATCTTGTGG + Intergenic
913804157 1:122763104-122763126 GTGGATATTCTGACATCTTGTGG + Intergenic
913804249 1:122764803-122764825 GTGGATATTCTGACATCTTGTGG + Intergenic
913804532 1:122769905-122769927 GTGGATATTCTGACATCTTGTGG + Intergenic
913804980 1:122778069-122778091 GTGGATATTCTGACATCTTGTGG + Intergenic
913805093 1:122780109-122780131 GTGGATATTCTGACATCTTGTGG + Intergenic
913805226 1:122782490-122782512 GTGGATATTCTGACATCTTCTGG + Intergenic
913805379 1:122785208-122785230 GTGGATATTCTGACATCTTGTGG + Intergenic
913805738 1:122791670-122791692 GTGGATATTCTGACATCTTGTGG + Intergenic
913805790 1:122792689-122792711 GTGGATATTCTGACATCTTGTGG + Intergenic
913805911 1:122794729-122794751 GTGGATATTCTGACATCTTGTGG + Intergenic
913806025 1:122796768-122796790 GTGGATATTCTGACATCTTGTGG + Intergenic
913806081 1:122797787-122797809 GTGGATATTCTGACATCTTGTGG + Intergenic
913806410 1:122803568-122803590 GTGGATATTCTGACATCTTGTGG + Intergenic
913806466 1:122804587-122804609 GTGGATATTCTGACATCTTGTGG + Intergenic
913806669 1:122808327-122808349 GTGGATATTCTGACATCTTGTGG + Intergenic
913806727 1:122809346-122809368 GTGGATATTCTGACATCTTGTGG + Intergenic
913806783 1:122810366-122810388 GTGGATATTCTGACATCTTGTGG + Intergenic
913806958 1:122813423-122813445 GTGGATATTCTGACATCTTGTGG + Intergenic
913807039 1:122814784-122814806 GTGGATATTCTGACATCTTGTGG + Intergenic
913807190 1:122817505-122817527 GTGGATATTCTGACATCTTGTGG + Intergenic
913807286 1:122819205-122819227 GTGGATATTCTGACATCTTGTGG + Intergenic
913807341 1:122820225-122820247 GTGGATATTCTGACATCTTGTGG + Intergenic
913807647 1:122825679-122825701 GTGGATATTCTGACATCTTGTGG + Intergenic
913807808 1:122828738-122828760 GTGGATATTCTGACATCTTGTGG + Intergenic
913807878 1:122830097-122830119 GTGGATATTCTGACATCTTGTGG + Intergenic
913807938 1:122831116-122831138 GTGGATATTCTGACATCTTGTGG + Intergenic
913808048 1:122833151-122833173 GTGGATATTCTGACATCTTGTGG + Intergenic
913808215 1:122836213-122836235 GTGGATATTCTGACATCTTGTGG + Intergenic
913808331 1:122838253-122838275 GTGGATATTCTGACATCTTGTGG + Intergenic
913808447 1:122840292-122840314 GTGGATATTCTGACATCTTGTGG + Intergenic
913808634 1:122843695-122843717 GTGGATATTCTGACATCTTGTGG + Intergenic
913808707 1:122845057-122845079 GTGGATATTCTGACATCTTGTGG + Intergenic
913808855 1:122847777-122847799 GTGGATATTCTGACATCTTGTGG + Intergenic
913809141 1:122852877-122852899 GTGGATATTCCGACATCTTTTGG + Intergenic
913809243 1:122854577-122854599 GTGGATATTCTGACATCTTGTGG + Intergenic
913809299 1:122855597-122855619 GTGGATATTCTGACATCTTGTGG + Intergenic
913809356 1:122856616-122856638 GTGGATATCCTGACATCTTGTGG + Intergenic
913809486 1:122858994-122859016 GTGGATATTCTGACATCTTGTGG + Intergenic
913809546 1:122860013-122860035 GTGGATATTCTGACATCTTGTGG + Intergenic
913809604 1:122861032-122861054 GTGGATATTCTGACATCTTGTGG + Intergenic
913809730 1:122863412-122863434 GTGCATATTCTGACATCTTGTGG + Intergenic
913809786 1:122864432-122864454 GTGGATATTCTGACATCTTGTGG + Intergenic
913809845 1:122865451-122865473 GTGGATATTCTGACATCTTGTGG + Intergenic
913809903 1:122866470-122866492 GTGGATATTCTGACATCTTGTGG + Intergenic
913810186 1:122871571-122871593 GTGGATATTCTGACATCTTGTGG + Intergenic
913810262 1:122872930-122872952 GTGGATATTCTGACATCTTGTGG + Intergenic
913810314 1:122873947-122873969 GTGGATATTCTGACATCTTGTGG + Intergenic
913810462 1:122876666-122876688 GTGGATATTCTGACATCTTGTGG + Intergenic
913810787 1:122882444-122882466 GTGGATATTCTGACATCTTGCGG + Intergenic
913810811 1:122882783-122882805 GTGGATATTCTGACATCTTGTGG + Intergenic
913810845 1:122883463-122883485 GTGGATATTCTGACATCTTGTGG + Intergenic
913810865 1:122883802-122883824 GTGGATATTCTGACATCTTGTGG + Intergenic
913810921 1:122884820-122884842 GTGGATATTCTGACATCTTGTGG + Intergenic
913811326 1:122891965-122891987 GTGGATATTCTGACATCTTGTGG + Intergenic
913811384 1:122892984-122893006 GTGGATATTCTGACATCTTCTGG + Intergenic
913811441 1:122894003-122894025 GTGGATATTCTGACATCTTGTGG + Intergenic
913811628 1:122897401-122897423 GTGGATATTCTGACATCTTGTGG + Intergenic
913811997 1:122903863-122903885 GTGGATATTCTGACATCTTGTGG + Intergenic
913812093 1:122905564-122905586 GTGGATATTCTGACATCTTGTGG + Intergenic
913812304 1:122909304-122909326 GTGGATATTCTGACATCTTGTGG + Intergenic
913812359 1:122910323-122910345 GTGGATATTCTGACATCTTGTGG + Intergenic
913812665 1:122915763-122915785 GTGGATATTCTGACATCTTGTGG + Intergenic
913812718 1:122916785-122916807 GTGGATATTCTGACATCTTGTGG + Intergenic
913812773 1:122917804-122917826 GTGGATATTCTGACATCTTGTGG + Intergenic
913812831 1:122918824-122918846 GTGGATATTCTGACATCTTGTGG + Intergenic
913812937 1:122920864-122920886 GTGGATATTCTGACATCTTGTGG + Intergenic
913812994 1:122921886-122921908 GTGGATATTCTGACATCTTGTGG + Intergenic
913813267 1:122926648-122926670 GTGGATATTCTGACATCTTGTGG + Intergenic
913813637 1:122933447-122933469 GTGGATATTCTGACATCTTGTGG + Intergenic
913813695 1:122934467-122934489 GTGGATATTCTGACATCTTGAGG + Intergenic
913813806 1:122936508-122936530 GTGGATATTCTGACATCTTGTGG + Intergenic
913813884 1:122937866-122937888 GTGGATATTCTGACATCTTGTGG + Intergenic
913813960 1:122939229-122939251 GTGGATATTCTGACATCTTGTGG + Intergenic
913814072 1:122941270-122941292 GTGGATATTCTGACATCTTGTGG + Intergenic
913814510 1:122949092-122949114 GTGGATATTCTGACATCTTGTGG + Intergenic
913814566 1:122950111-122950133 GTGGATATTCTGACATCTTGTGG + Intergenic
913814768 1:122953849-122953871 GTGGATATTCTGACATCTTGTGG + Intergenic
913814830 1:122954866-122954888 GTGGATATTCTGACATCTTGTGG + Intergenic
913814909 1:122956223-122956245 GTGGATATTCTGACATCTTGTGG + Intergenic
913815020 1:122958263-122958285 GTGGATATTCTGACATCTTGTGG + Intergenic
913815085 1:122959281-122959303 GTGGATATTCTGACATCTTGTGG + Intergenic
913815146 1:122960304-122960326 GTGGATATTCTGACATCTTGTGG + Intergenic
913815266 1:122962683-122962705 GTGGATATTCTGACATCTTGTGG + Intergenic
913815326 1:122963703-122963725 GTGGATATTCTGACATCTTGTGG + Intergenic
913815442 1:122965744-122965766 GTGGATATTCTGACATCTTGTGG + Intergenic
913815557 1:122967783-122967805 GTGGATATTCTGACATCTTGTGG + Intergenic
913815679 1:122969822-122969844 GTGGATATTCTGACATCTTGTGG + Intergenic
913815757 1:122971182-122971204 GTGGATATTCTGACATCTTGTGG + Intergenic
913815845 1:122972882-122972904 GTGGATATTCTGACATCTTGTGG + Intergenic
913815903 1:122973902-122973924 GTGGATATTCTGACATCTTGTGG + Intergenic
913816081 1:122976959-122976981 GTGGATATTCTGACATCTTGTGG + Intergenic
913816323 1:122981044-122981066 GTGGATATTCTGACATCTTGTGG + Intergenic
913816381 1:122982063-122982085 GTGGATATTCTGACATCTTGTGG + Intergenic
913816440 1:122983083-122983105 GTGGATATTCTGACATCTTGTGG + Intergenic
913816512 1:122984442-122984464 GTGGATATTCTGACATCTTGTGG + Intergenic
913816567 1:122985461-122985483 GTGGATATTCTGACATCTTGTGG + Intergenic
913816623 1:122986480-122986502 GTGGATATTCTGACATCTTGTGG + Intergenic
913816732 1:122988518-122988540 GTGGATATTCTGACATCTTGTGG + Intergenic
913816902 1:122991577-122991599 GTGGATATTCTGACATCTTCTGG + Intergenic
913816958 1:122992596-122992618 GTGGATATTCTGACATCTTGTGG + Intergenic
913817151 1:122995995-122996017 GTGGATATTCTGACATCTTGTGG + Intergenic
913817261 1:122998034-122998056 GTGGATATTCTGACATCTTGTGG + Intergenic
913817318 1:122999046-122999068 GTGGATATTCTGACATCTTGTGG + Intergenic
913817378 1:123000065-123000087 GTGGATATTCTGACATCTTGTGG + Intergenic
913817495 1:123002103-123002125 GTGGATATTCTGACATCTTTTGG + Intergenic
913817617 1:123004143-123004165 GTGGATATTCTGACATCTTGTGG + Intergenic
913817670 1:123005162-123005184 GTGGATATTCTGACATCTTATGG + Intergenic
913817807 1:123007541-123007563 GTGGATATTCTGACATCTTGTGG + Intergenic
913818022 1:123011284-123011306 GTGGATATTCTGACATCTTGTGG + Intergenic
913818079 1:123012301-123012323 GTGGATATTCTGACATCTTGTGG + Intergenic
913818141 1:123013321-123013343 GTGGATATTCTGACATCTTGTGG + Intergenic
913818196 1:123014341-123014363 GTGGATATTCTGACATCTTGTGG + Intergenic
913818304 1:123016379-123016401 GTGGATATTCTGACATCTTGTGG + Intergenic
913818421 1:123018417-123018439 GTGGATATTCTGACATCTTGTGG + Intergenic
913818542 1:123020455-123020477 GTGGATATTCTGACATCTTGTGG + Intergenic
913818606 1:123021474-123021496 GTGGATATTCTGACATCTTGTGG + Intergenic
913818680 1:123022833-123022855 GTGGATATTCTGACATCTTGCGG + Intergenic
913818737 1:123023852-123023874 GTGGATATTCTGACATCTTGTGG + Intergenic
913818813 1:123025211-123025233 GTGGATATTCTGACATCTTGTGG + Intergenic
913818848 1:123025890-123025912 GTGGATATTCTGACATCTTGTGG + Intergenic
913818909 1:123026910-123026932 GTGGATATTCTGACATCTTGTGG + Intergenic
913818964 1:123027925-123027947 GTGGATATTCTGACATCTTGTGG + Intergenic
913819114 1:123030644-123030666 GTGGATATTCTGACATCTTGTGG + Intergenic
913819170 1:123031663-123031685 GTGGATATTCTGACATCTTGTGG + Intergenic
913819343 1:123034722-123034744 GTGGATATTCTGACATCTTGTGG + Intergenic
913819451 1:123036759-123036781 GTGGATATTCTGACATCTTGTGG + Intergenic
913819505 1:123037778-123037800 GTGGATATTCTGACATCTTGTGG + Intergenic
913819622 1:123039818-123039840 GTGGATATTCTGACATCTTGTGG + Intergenic
913819674 1:123040838-123040860 GTGGATATTCTGACATCTTGTGG + Intergenic
913819807 1:123043217-123043239 GTGGATATTCTGACATCTTGTGG + Intergenic
913819865 1:123044240-123044262 GTGGATATTCTGACATCTTGTGG + Intergenic
913819919 1:123045261-123045283 GTGGATATTCTGACATCTTGTGG + Intergenic
913820305 1:123052064-123052086 GTGGATATTCTGACATCTTGTGG + Intergenic
913820540 1:123056144-123056166 GTGGATATTCTGACATCTTGTGG + Intergenic
913820599 1:123057163-123057185 GTGGATATTCTGACATCTTGTGG + Intergenic
913820671 1:123058521-123058543 GTGGATATTCTGACATCTTGTGG + Intergenic
913820797 1:123060903-123060925 GTGGATATTCTGACATCTTGTGG + Intergenic
913820911 1:123062942-123062964 GTGGATATTCTGACATCTTGTGG + Intergenic
913820967 1:123063961-123063983 GTGGATATTCTGACATCTTGTGG + Intergenic
913821024 1:123064974-123064996 GTGGATATTCTGACATCTTGTGG + Intergenic
913821099 1:123066333-123066355 GTGGATATTCTGACATCTTGTGG + Intergenic
913821431 1:123072455-123072477 GTGGATACTCTGACATCTTGTGG + Intergenic
913821543 1:123074494-123074516 GTGGATATTCTGACATCTTGTGG + Intergenic
913821673 1:123076873-123076895 GTGGATATTCTGACATCTTGTGG + Intergenic
913821728 1:123077892-123077914 GTGGATATTCTGACATCTTGTGG + Intergenic
913821785 1:123078911-123078933 GTGGATATTCTGACATCTTGTGG + Intergenic
913821840 1:123079931-123079953 GTGGATATTCTGACATCTTGTGG + Intergenic
913821897 1:123080950-123080972 GTGGATATTCTGACATCTTGTGG + Intergenic
913822001 1:123082650-123082672 GTGGATATTCTGACATCTTGTGG + Intergenic
913822021 1:123082989-123083011 GTGGATATTCTGACATCTTGTGG + Intergenic
913822386 1:123089448-123089470 GTGGATATTCTGACATCTTGTGG + Intergenic
913822441 1:123090467-123090489 GTGGATATTCTGACATCTTGTGG + Intergenic
913822494 1:123091487-123091509 GTGGATATTCTGACATCTTGTGG + Intergenic
913822767 1:123096247-123096269 GTGGATATTCTGACATCTTGTGG + Intergenic
913822830 1:123097266-123097288 GTGGATATTCTGACATCTTGTGG + Intergenic
913822962 1:123099648-123099670 GTGGATATTCTGACATCTTGTGG + Intergenic
913823066 1:123101520-123101542 GTGGATATTCTGACATCTTGTGG + Intergenic
913823119 1:123102537-123102559 GTGGATATTCTGACATCTTGTGG + Intergenic
913823174 1:123103557-123103579 GTGGATATTCTGACATCTTGTGG + Intergenic
913823434 1:123108313-123108335 GTGGATATTCTGACATCTTGTGG + Intergenic
913823571 1:123110693-123110715 GTGGATATTCTGACATCTTGTGG + Intergenic
913823622 1:123111713-123111735 GTGGATATTCTGACATCTTGTGG + Intergenic
913823679 1:123112733-123112755 GTGGATATTCTGACATCTTGTGG + Intergenic
913823750 1:123114088-123114110 GTGGATATTCTGACATCTTGTGG + Intergenic
913824126 1:123121226-123121248 GTGGATATTCTGACATCTTGTGG + Intergenic
913824263 1:123123606-123123628 GTGGATATTCTGACATCTTGTGG + Intergenic
913824379 1:123125645-123125667 GTGGATATTCTGACATCTTGTGG + Intergenic
913824435 1:123126663-123126685 GTGGATATTCTGACATCTTGTGG + Intergenic
913824528 1:123128362-123128384 GTGGATATTCTGACATCTTGTGG + Intergenic
913824707 1:123131425-123131447 GTGGATATTCTGACATCTTGTGG + Intergenic
913824784 1:123132784-123132806 GTGGATATTCTGACATCTTGTGG + Intergenic
913825013 1:123136864-123136886 GTGGATATTCTGACATCTTGTGG + Intergenic
913825070 1:123137883-123137905 GTGGATATTCTGACATCTTGTGG + Intergenic
913825128 1:123138903-123138925 GTGGATATTCTGACATCTTGTGG + Intergenic
913825376 1:123143322-123143344 GTGGATATTCTGACATCTTGTGG + Intergenic
913825715 1:123149437-123149459 GTGGATATTCTGACATCTTGTGG + Intergenic
913825934 1:123153180-123153202 GTGGATATTCTGACATCTTGTGG + Intergenic
913826111 1:123156240-123156262 GTGGATATTCTGACATCTTGTGG + Intergenic
913826170 1:123157260-123157282 GTGGATATTCTGACATCTTGTGG + Intergenic
913826228 1:123158281-123158303 GTGGATATTCTGACATCTTGTGG + Intergenic
913826333 1:123160322-123160344 GTGGATATTCTGACATCTTGTGG + Intergenic
913826392 1:123161343-123161365 GTGGATATTCTGACATCTTGTGG + Intergenic
913826560 1:123164402-123164424 GTGGATATTCTGACATCTTGTGG + Intergenic
913826673 1:123166441-123166463 GTGGATATTCTGACATCTTGTGG + Intergenic
913826794 1:123168485-123168507 GTGGATATTCTGACATCTTGTGG + Intergenic
913826930 1:123170867-123170889 GTGGATATTCTGACATCTTGTGG + Intergenic
913827099 1:123173924-123173946 GTGGATATTCTGACATCTTGTGG + Intergenic
913827161 1:123174944-123174966 GTGGATATTCTGACATCTTGTGG + Intergenic
913827334 1:123178001-123178023 GTGGATATTCTGACATCTTGTGG + Intergenic
913827450 1:123180045-123180067 GTGGATATTCTGACATCTTGTGG + Intergenic
913827504 1:123181067-123181089 GTGGATATTCTGACATCTTGTGG + Intergenic
913827558 1:123182087-123182109 GTGGATATTCTGACATCTTGTGG + Intergenic
913827721 1:123185151-123185173 GTGGATATTCTGACATCTTGTGG + Intergenic
913827812 1:123186849-123186871 GTGGATATTCTGACATTTTTTGG + Intergenic
913827874 1:123187869-123187891 GTGGATATTCTGACATCTTGTGG + Intergenic
913828063 1:123191269-123191291 GTGGATATTCTGACATCTTGTGG + Intergenic
913828172 1:123193307-123193329 GTGGATATTCTGACATCTTGTGG + Intergenic
913828287 1:123195347-123195369 GTGGATATTCTGACATCTTGTGG + Intergenic
913828340 1:123196367-123196389 GTGGATATTCTGACATCTTGTGG + Intergenic
913828399 1:123197387-123197409 GTGGATATTCTGACATCTTGTGG + Intergenic
913828459 1:123198407-123198429 GTGGATATTCTGACATCTTGTGG + Intergenic
913828511 1:123199426-123199448 GTGGATATTCTGACATCTTGTGG + Intergenic
913828631 1:123201465-123201487 GTGGATATTCTGACATCTTGTGG + Intergenic
913828757 1:123203841-123203863 GTGGATATTCTGACATCTTGTGG + Intergenic
913828818 1:123204861-123204883 GTGGATATTCTGACATCTTGTGG + Intergenic
913828876 1:123205883-123205905 GTGGATATTCTGACATCTTGTGG + Intergenic
913828931 1:123206903-123206925 GTGGATATTCTGACATCTTGTGG + Intergenic
913829103 1:123209964-123209986 GTGGATATTCTGACATCTTGTGG + Intergenic
913829273 1:123213025-123213047 GTGGATATTCTGACATCTTGTGG + Intergenic
913829327 1:123214043-123214065 GTGGATATTCTGACATCTTGTGG + Intergenic
913829485 1:123217097-123217119 GTGGATATTCTGACATCTTGTGG + Intergenic
913829657 1:123220156-123220178 GTGGATATTCTGACATCTTGTGG + Intergenic
913829710 1:123221146-123221168 GTGGATATTCTGACATCTTGTGG + Intergenic
913829763 1:123222164-123222186 GTGGATATTCTGACATCTTGTGG + Intergenic
913829934 1:123225222-123225244 GTGGATATTCTGACATCTTGAGG + Intergenic
913830008 1:123226584-123226606 GTGGATATTCTGACATCTTGCGG + Intergenic
913830245 1:123230659-123230681 GTGGATATTCTGACATCTTGTGG + Intergenic
913830298 1:123231678-123231700 GTGGATATTCTGACATCTTGTGG + Intergenic
913830354 1:123232698-123232720 GTGGATATTCTGACATCTTGTGG + Intergenic
913830511 1:123235758-123235780 GTGGATATTCTGACATCTTGTGG + Intergenic
913830561 1:123236777-123236799 GTGGATATTCTGACATCTTGTGG + Intergenic
913830733 1:123239836-123239858 GTGGATATTCTGACATCTTGTGG + Intergenic
913830847 1:123241875-123241897 GTGGATATTCTGACATCTTGTGG + Intergenic
913830926 1:123243234-123243256 GTGGATATTCTGACATCTTGTGG + Intergenic
913830985 1:123244253-123244275 GTGGATATTCTGACATCTTGTGG + Intergenic
913831040 1:123245272-123245294 GTGGATATTCTGACATCTTGTGG + Intergenic
913831220 1:123248325-123248347 GTGGATATTCTGACATCTTGTGG + Intergenic
913831276 1:123249346-123249368 GTGGATATTCTGACATCTTGTGG + Intergenic
913831383 1:123251389-123251411 GTGGATATTCTGACATCTTGTGG + Intergenic
913831551 1:123254445-123254467 GTGGATATTCTGACATCTTGTGG + Intergenic
913831606 1:123255463-123255485 GTGGATATTCTGACATCTTGTGG + Intergenic
913831719 1:123257498-123257520 GTGGATATTCTGACATCTTGTGG + Intergenic
913831773 1:123258520-123258542 GTGGATATTCTGACATCTTGTGG + Intergenic
913832615 1:123273315-123273337 GTGGATATTCTGACATCTTGTGG + Intergenic
913832668 1:123274335-123274357 GTGGATATTCTGACATCTTGTGG + Intergenic
913832775 1:123276377-123276399 GTGGATATTCTGACATCTTGTGG + Intergenic
913832835 1:123277395-123277417 GTGGATATTCTGACATCTTGTGG + Intergenic
913832895 1:123278411-123278433 GTGGATATTCTGACATCTTGTGG + Intergenic
913832956 1:123279430-123279452 GTGGATATTCTGACATCTTGTGG + Intergenic
913833074 1:123281465-123281487 GTGGATATTCTGACATCTTGTGG + Intergenic
913833255 1:123284863-123284885 GTGGATATTCTGACATCTTGTGG + Intergenic
913833314 1:123285882-123285904 GTGGATATTCTGACATCTTGTGG + Intergenic
913833376 1:123286901-123286923 GTGGATATTCTGACATCTTGTGG + Intergenic
913833475 1:123288602-123288624 GTGGATATTCTGACATCTTGTGG + Intergenic
913833586 1:123290641-123290663 GTGGATATTCTGACATCTTGTGG + Intergenic
913833756 1:123293703-123293725 GTGGATATTCTGACATCTTGTGG + Intergenic
913833815 1:123294721-123294743 GTGGATATTCTGACATCTTGTGG + Intergenic
913833873 1:123295741-123295763 GTGGATATTCTGACATCTTGTGG + Intergenic
913833934 1:123296760-123296782 GTGGATATTCTGACATCTTGTGG + Intergenic
913833994 1:123297781-123297803 GTGGATATTCTGACATCTTGTGG + Intergenic
913834218 1:123301859-123301881 GTGGATATTCTGACATCTTGTGG + Intergenic
913834528 1:123307126-123307148 GTGGATATTCTGACATCTTGTGG + Intergenic
913834715 1:123310528-123310550 GTGGATATTCTGACATCTTGTGG + Intergenic
913834882 1:123313585-123313607 GTGGATATTCTGACATCTTGTGG + Intergenic
913834940 1:123314606-123314628 GTGGATATTCTGACATCTTGTGG + Intergenic
913834995 1:123315632-123315654 GTGGATATTCTGACATCTTGTGG + Intergenic
913835127 1:123318011-123318033 GTGGATATTCTGACATCTTGTGG + Intergenic
913835242 1:123320048-123320070 GTGGATATTCTGACATCTTGTGG + Intergenic
913835353 1:123322090-123322112 GTGGATATTCTGACATCTTGTGG + Intergenic
913835466 1:123324132-123324154 GTGGATATTCTGACATCTTGTGG + Intergenic
913835528 1:123325151-123325173 GTGGATATTCTGACATCTTGTGG + Intergenic
913835588 1:123326171-123326193 GTGGATATTCTGACATCTTGTGG + Intergenic
913835706 1:123328214-123328236 GTGGATATTCTGACATCTTGTGG + Intergenic
913835768 1:123329233-123329255 GTGGATATTCTGACATCTTGTGG + Intergenic
913835821 1:123330252-123330274 GTGGATATTCTGACATCTTGTGG + Intergenic
913835957 1:123332633-123332655 GTGGATATTCTGACATCTTGTGG + Intergenic
913836017 1:123333652-123333674 GTGGATATTCTGACATCTTGTGG + Intergenic
913836191 1:123336706-123336728 GTGGATATTCTGACATCTTGTGG + Intergenic
913836245 1:123337725-123337747 GTGGATATTCTGACATCTTGTGG + Intergenic
913836300 1:123338744-123338766 GTGGATATTCTGACATCTTGTGG + Intergenic
913836473 1:123341805-123341827 GTGGATATTCTGACATCTTGTGG + Intergenic
913836533 1:123342825-123342847 GTGGATACTCTGACATCTTGTGG + Intergenic
913836588 1:123343844-123343866 GTGGATATTCTGACATCTTGTGG + Intergenic
913836639 1:123344864-123344886 GTGGATATTCTGACATCTTGTGG + Intergenic
913836695 1:123345882-123345904 GTGGATATGCTGACATCTTGTGG + Intergenic
913836865 1:123348941-123348963 GTGGATATTCTGTCATCTTTTGG + Intergenic
913836983 1:123350980-123351002 GTGGATATTCTGACATCTTGTGG + Intergenic
913837108 1:123353358-123353380 GTGGATATTCTGACATCTTGTGG + Intergenic
913837169 1:123354377-123354399 GTGGATATTCTGACATCTTGTGG + Intergenic
913837282 1:123356415-123356437 GTGGATATTCTGACATCTTGTGG + Intergenic
913837399 1:123358449-123358471 GTGGATATTCTGACATCTTGTGG + Intergenic
913837515 1:123360489-123360511 GTGGATATTCTGACATCTTGTGG + Intergenic
913837574 1:123361508-123361530 GTGGATATTCTGACATCTTGTGG + Intergenic
913837630 1:123362529-123362551 GTGGATATTCTGACATCTTGTGG + Intergenic
913837686 1:123363549-123363571 GTGGATATTCTGACATCTTGTGG + Intergenic
913837739 1:123364568-123364590 GTGGATATTCTGACATCTTGTGG + Intergenic
913837917 1:123367628-123367650 GTGGATATTCTGACATCTTGTGG + Intergenic
913838102 1:123371024-123371046 GTGGATATTCTGACATCTTGTGG + Intergenic
913838183 1:123372383-123372405 GTGGATATTCTGACATCTTGTGG + Intergenic
913838245 1:123373403-123373425 GTGGATATTCTGACATCTTGTGG + Intergenic
913838302 1:123374423-123374445 GTGGATATTCTGACATCTTGTGG + Intergenic
913838418 1:123376463-123376485 GTGGATATTCTGACATCTTGTGG + Intergenic
913838526 1:123378502-123378524 GTGGATATTCTGACATCTTGTGG + Intergenic
913838579 1:123379521-123379543 GTGGATATTCTGACATCTTGTGG + Intergenic
913838919 1:123385634-123385656 GTGGATATTCTGACATCTTGTGG + Intergenic
913839036 1:123387669-123387691 GTGGATATTCTGACATCTTGTGG + Intergenic
913839149 1:123389705-123389727 GTGGATATTCTGACATCTTGTGG + Intergenic
913839266 1:123391745-123391767 GTGGATATTCTGACATCTTGTGG + Intergenic
913839325 1:123392764-123392786 GTGGATATTCTGACATCTTGTGG + Intergenic
913839381 1:123393784-123393806 GTGGATATTCTGACATCTTGTGG + Intergenic
913839495 1:123395824-123395846 GTGGATATTCTGACATCTTGTGG + Intergenic
913839554 1:123396845-123396867 GTGGATATTCTGACATCTTGTGG + Intergenic
913839779 1:123400930-123400952 GTGGATATTCTGACATCTTGTGG + Intergenic
913839892 1:123402969-123402991 GTGGATATTCTGACATCTTGTGG + Intergenic
913839949 1:123403990-123404012 GTGGATATTCTGACATCTTGTGG + Intergenic
913840004 1:123405009-123405031 GTGGATATTCTGACATCTTGTGG + Intergenic
913840117 1:123407047-123407069 GTGGATATTCTGACATCTTGTGG + Intergenic
913840171 1:123408067-123408089 GTGGATATTCTGACATCTTGTGG + Intergenic
913840342 1:123411120-123411142 GTGGATATTCTGACATCTTGTGG + Intergenic
913840396 1:123412139-123412161 GTGGATATTCTGACATCTTGTGG + Intergenic
913840569 1:123415198-123415220 GTGGATATTCTGACATCTTGTGG + Intergenic
913840734 1:123418255-123418277 GTGGATATTCTGACATCTTGTGG + Intergenic
913840872 1:123420635-123420657 GTGGATATTCTGACATCTTGTGG + Intergenic
913841112 1:123424717-123424739 GTGGATATTCTGACATCTTGTGG + Intergenic
913841547 1:123432198-123432220 GTGGATATTCTGACATCTTGTGG + Intergenic
913841716 1:123435255-123435277 GTGGATATTCTGACATCTTGTGG + Intergenic
913841833 1:123437293-123437315 GTGGATATTCTGACATCTTGTGG + Intergenic
913841948 1:123439326-123439348 GTGGATATTCTGACATCTTGTGG + Intergenic
913842001 1:123440346-123440368 GTGAATATTCTGACATCTTGTGG + Intergenic
913842058 1:123441367-123441389 GTGGATATTCTGACATCTTGTGG + Intergenic
913842111 1:123442386-123442408 GTGGATATTCTGACATCTTGTGG + Intergenic
913842230 1:123444425-123444447 GTGGATATTCTGACATCTTGGGG + Intergenic
913842448 1:123448508-123448530 GTGGATATTCTGACATCTTGTGG + Intergenic
913842505 1:123449527-123449549 GTGGATATTCTGACATCTTGTGG + Intergenic
913842558 1:123450546-123450568 GTGGATATTCTGACATCTTGTGG + Intergenic
913842778 1:123454458-123454480 GTGGATATTCTGACATCTTGTGG + Intergenic
913842833 1:123455477-123455499 GTGGATATTCTGACATCTTGTGG + Intergenic
913842943 1:123457517-123457539 GTGGATATTCTGACATCTTGTGG + Intergenic
913843062 1:123459548-123459570 GTGGATATTCTGACATCTTGTGG + Intergenic
913843117 1:123460567-123460589 GTGGATATTCTGACATCTTGTGG + Intergenic
913843174 1:123461587-123461609 GTGGATATTCTGACATCTTGTGG + Intergenic
913843279 1:123463626-123463648 GTGGATATTCTGACATCTTGTGG + Intergenic
913843335 1:123464644-123464666 GTGGATATTCTGACATCTTGTGG + Intergenic
913843391 1:123465663-123465685 GTGGATATTCTGACATCTTGTGG + Intergenic
913843449 1:123466683-123466705 GTGGATATTCTGACATCTTGTGG + Intergenic
913843567 1:123468726-123468748 GTGGATATTCTGACATCTTGTGG + Intergenic
913843813 1:123473148-123473170 GTGGATATTCTGACATCTTGTGG + Intergenic
913843866 1:123474163-123474185 GTGGATATTCTGACATCTTGTGG + Intergenic
913843924 1:123475182-123475204 GTGGATATTCTGACATCTTGTGG + Intergenic
913843973 1:123476203-123476225 GTGGATATTCTGACATCTTGTGG + Intergenic
913844198 1:123480280-123480302 GTGGATATTCTGACATCTTGTGG + Intergenic
913844318 1:123482320-123482342 GTGGATATTCTGACATCTTGTGG + Intergenic
913844431 1:123484361-123484383 GTGGATATTCTGACATCTTGTGG + Intergenic
913844547 1:123486400-123486422 GTGGATATTCTGACATCTTGTGG + Intergenic
913844711 1:123489461-123489483 GTGGATATTCTGACATCTTGTGG + Intergenic
913844997 1:123494558-123494580 GTGGATATTCTGACATCTTGTGG + Intergenic
913845053 1:123495577-123495599 GTGGATATTCTGACATCTTGTGG + Intergenic
913845167 1:123497619-123497641 GTGGATATTCTGACATCTTGTGG + Intergenic
913845442 1:123502717-123502739 GTGGATATTCTGACATCTTGTGG + Intergenic
913845609 1:123505777-123505799 GTGGATATTCTGACATCTTGTGG + Intergenic
913845665 1:123506796-123506818 GTGGATATTCTGACATCTTGTGG + Intergenic
913846006 1:123512916-123512938 GTGGATATTCTGACATCTTGTGG + Intergenic
913846293 1:123518015-123518037 GTGGATATTCTGACATCTTGTGG + Intergenic
913846460 1:123521075-123521097 GTGGATATTCTGACATCTTGTGG + Intergenic
913846566 1:123523113-123523135 GTGGATATTCTGACATCTTGTGG + Intergenic
913846753 1:123526513-123526535 GTGGATATTCTGACATCTTGTGG + Intergenic
913847124 1:123533314-123533336 GTGGATATTCTGACATCTTGTGG + Intergenic
913847236 1:123535350-123535372 GTGGATATTCTGACATCTTGTGG + Intergenic
913847410 1:123538410-123538432 GTGGATATTCTGACATCTTGTGG + Intergenic
913847526 1:123540448-123540470 GTGGATATTCTGACATCTTGTGG + Intergenic
913847641 1:123542490-123542512 GTGGATATTCTGACATCTTGTGG + Intergenic
913847750 1:123544530-123544552 GTGGATATTCTGACATCTTGTGG + Intergenic
913847806 1:123545549-123545571 GTGGATATTCTGACATCTTGTGG + Intergenic
913847867 1:123546561-123546583 GTGGATATTCTGACATCTTGTGG + Intergenic
913847920 1:123547579-123547601 GTGGATATTCTGACATCTTGTGG + Intergenic
913848226 1:123553021-123553043 GTGGATATTCTGACATCTTGTGG + Intergenic
913848278 1:123554040-123554062 GTGGATATTCTGACATCTTGTGG + Intergenic
913848382 1:123556080-123556102 GTGGATATTCTGACATCTTGTGG + Intergenic
913848434 1:123557099-123557121 GTGGATATTCTGACATCTTGTGG + Intergenic
913848778 1:123563220-123563242 GTGGATATTCTGACATCTTGTGG + Intergenic
913848892 1:123565258-123565280 GTGGATATTCTGACATCTTGTGG + Intergenic
913848945 1:123566278-123566300 GTGGATATTCTGACATCTTGTGG + Intergenic
913849001 1:123567292-123567314 GTGGATATTCTGACATCTTGTGG + Intergenic
913849057 1:123568312-123568334 GTGGATATTCTGACATCTTGTGG + Intergenic
913849345 1:123573414-123573436 GTGGATATTCTGACATCTTGTGG + Intergenic
913849636 1:123578508-123578530 GTGGATATTCTGACATCTTGTGG + Intergenic
913849694 1:123579527-123579549 GTGGATATTCTGACATCTTGTGG + Intergenic
913849750 1:123580544-123580566 GTGGATATTCTGACATCTTGTGG + Intergenic
913850034 1:123585646-123585668 GTGGATATTCTGACATCTTGTGG + Intergenic
913850088 1:123586660-123586682 GTGGATATTCTGACATCTTGTGG + Intergenic
913850108 1:123586999-123587021 GTGGATATTCAGACATCTTTGGG + Intergenic
913850143 1:123587680-123587702 GTGGATATTCTGACATCTTGTGG + Intergenic
913850203 1:123588700-123588722 GTGGATATTCTGACATCTTGTGG + Intergenic
913850397 1:123592100-123592122 GTGGATATTCTGACATCTTGTGG + Intergenic
913850514 1:123594139-123594161 GTGGATATTCTGACATCTTGTGG + Intergenic
913850627 1:123596183-123596205 GTGGATATTCTGACATCTTGTGG + Intergenic
913850798 1:123599243-123599265 GTGGATATTCTGACATCTTGTGG + Intergenic
913850849 1:123600261-123600283 GTGGATATTCTGACATCTTGTGG + Intergenic
913850965 1:123602300-123602322 GTGGATATTCTGACATCTTGTGG + Intergenic
913851023 1:123603320-123603342 GTGGATATTCTGACATCTTGTGG + Intergenic
913851200 1:123606380-123606402 GTGGATATTCTGACATCTTTTGG + Intergenic
913851254 1:123607401-123607423 GTGGATATTCTGACATCTTGTGG + Intergenic
913851485 1:123611479-123611501 GTGGATATTCTGACATCTTGTGG + Intergenic
913851663 1:123614538-123614560 GTGGATATTCTGACATCTTGTGG + Intergenic
913851828 1:123617600-123617622 GTGGATATTCTGACATCTTGTGG + Intergenic
913851940 1:123619640-123619662 GTGGATATTCTGACATCTTGTGG + Intergenic
913851995 1:123620658-123620680 GTGGATATTCTGACATCTTGTGG + Intergenic
913852047 1:123621677-123621699 GTGGATATTCTGACATCTTGTGG + Intergenic
913852102 1:123622696-123622718 GTGGATATTCTGACATCTTGTGG + Intergenic
913852273 1:123625755-123625777 GTGGATATTCTGACATCTTGTGG + Intergenic
913852333 1:123626775-123626797 GTGGATATTCTGACATCTTGTGG + Intergenic
913852391 1:123627795-123627817 GTGGATATTCTGACATCTTGTGG + Intergenic
913852463 1:123629154-123629176 GTGGATATTCTGACATCTTGTGG + Intergenic
913852517 1:123630173-123630195 GTGGATATTCTGACATCTTGTGG + Intergenic
913852574 1:123631192-123631214 GTGGATATTCTGACATCTTGTGG + Intergenic
913852631 1:123632211-123632233 GTGGATATTCTGACATCTTGTGG + Intergenic
913852691 1:123633230-123633252 GTGGATATTCTGACATCTTGTGG + Intergenic
913852808 1:123635270-123635292 GTGGATATTCTGACATCTTGTGG + Intergenic
913852857 1:123636288-123636310 GTGGATATTCTGACATCTTGTGG + Intergenic
913852918 1:123637306-123637328 GTGGATATTCTGACATCTTGTGG + Intergenic
913853029 1:123639349-123639371 GTGGATATTCTGACATCTTGTGG + Intergenic
913853141 1:123641392-123641414 GTGGATATTCTGACATCTTGTGG + Intergenic
913853376 1:123645472-123645494 GTGGATATTCTGACATCTTGTGG + Intergenic
913853601 1:123649552-123649574 GTGGATATTCTGACATCTTGTGG + Intergenic
913853659 1:123650572-123650594 GTGGATATTCTGACATCTTGTGG + Intergenic
913853827 1:123653635-123653657 GTGGATATTCTGACATCTTGTGG + Intergenic
913854018 1:123657033-123657055 GTGGATATTCTGACATCTTGTGG + Intergenic
913854078 1:123658053-123658075 GTGGATATTCTGACATCTTGTGG + Intergenic
913854361 1:123663149-123663171 GTGGATATTCTGACATCTTGTGG + Intergenic
913854531 1:123666209-123666231 GTGGATATTCTGACATCTTGTGG + Intergenic
913854692 1:123669269-123669291 GTGGATATTCTGACATCTTGTGG + Intergenic
913854745 1:123670287-123670309 GTGGATATTCTGACATCTTGTGG + Intergenic
913854800 1:123671309-123671331 GTGGATATTCTGACATCTTGTGG + Intergenic
913855028 1:123675388-123675410 GTGGATATTCTGACATCTTGTGG + Intergenic
913855086 1:123676407-123676429 GTGGATATTCTGACATCTTGTGG + Intergenic
913855274 1:123679806-123679828 GTGGATATTCTGACATCTTGTGG + Intergenic
913855444 1:123682866-123682888 GTGGATATACTGACATCTTGTGG + Intergenic
913855617 1:123685928-123685950 GTGGATATTCTGACATCTTGTGG + Intergenic
913855950 1:123692046-123692068 GTGGATATTCTGACATCTTGTGG + Intergenic
913856320 1:123698842-123698864 GTGGATATTCTGACATCTTGAGG + Intergenic
913856492 1:123701903-123701925 GTGGATATTCTGACATCTTGTGG + Intergenic
913856549 1:123702922-123702944 GTGGATATTCTGACATCTTGTGG + Intergenic
913856608 1:123703943-123703965 GTGGATATTCTGACATCTTGTGG + Intergenic
913856739 1:123706322-123706344 GTGGATATTCTGACATCTTGTGG + Intergenic
913856855 1:123708361-123708383 GTGGATATTCTGACATCTTGTGG + Intergenic
913856967 1:123710400-123710422 GTGGATATTCTGACATCTTGTGG + Intergenic
913857376 1:123717875-123717897 GTGGATATTCTGACATCTTGTGG + Intergenic
913857434 1:123718894-123718916 GTGGATATTCTGACATCTTGTGG + Intergenic
913857484 1:123719913-123719935 GTGGATATTCTGACATCTTGTGG + Intergenic
913857545 1:123720932-123720954 GTGGATATTCTGACATCTTGTGG + Intergenic
913857605 1:123721952-123721974 GTGGATATTCTGACATCTTGTGG + Intergenic
913857723 1:123723992-123724014 GTGGATATTCTGACATCTTGTGG + Intergenic
913857834 1:123725857-123725879 GTGGATATTCTGACATCTTGTGG + Intergenic
913857885 1:123726876-123726898 GTGGATATTCTGACATCTTGTGG + Intergenic
913857938 1:123727895-123727917 GTGGATATTCTGACATCTTGTGG + Intergenic
913858052 1:123729934-123729956 GTGGATATTCTGACATCTTGTGG + Intergenic
913858111 1:123730955-123730977 GTGGATATTCTGACATCTTGTGG + Intergenic
913858613 1:123740136-123740158 GTGGATATTCTGACATCTTGTGG + Intergenic
913858674 1:123741155-123741177 GTGGATATTCTGACATCTTGTGG + Intergenic
913858728 1:123742176-123742198 GTGGATATTCTGACATCTTGTGG + Intergenic
913858838 1:123744215-123744237 GTGGATATTCTGACATCTTGTGG + Intergenic
913858895 1:123745232-123745254 GTGGATATTCTGACATCTTGTGG + Intergenic
913858950 1:123746250-123746272 GTGGATATTCTGACATCTTGTGG + Intergenic
913859009 1:123747269-123747291 GTGGATATTCTGACATCTTGTGG + Intergenic
913859185 1:123750330-123750352 GTGGATATTCTGACATCTTGTGG + Intergenic
913859411 1:123754408-123754430 GTGGATATTCTGACATCTTGTGG + Intergenic
913859648 1:123758489-123758511 GTGGATATTCTGACATCTTGTGG + Intergenic
913859768 1:123760529-123760551 GTGCATATTCTGACATCTTGTGG + Intergenic
913859882 1:123762569-123762591 GTGGATATTCTGACATCTTGTGG + Intergenic
913860115 1:123766651-123766673 GTGGATATTCTGACATCTTGTGG + Intergenic
913860177 1:123767670-123767692 GTGGATATTCTGACATCTTGTGG + Intergenic
913860256 1:123769029-123769051 GTGGATATTCTGACATCTTGTGG + Intergenic
913860315 1:123770048-123770070 GTGGATATTCTGACATCTTGTGG + Intergenic
913860373 1:123771067-123771089 GTGGATATTCTGACATCTTGTGG + Intergenic
913860431 1:123772088-123772110 GTGGATATTCTGACATCTTGTGG + Intergenic
913860487 1:123773108-123773130 GTGGATATTCTGACATCTTATGG + Intergenic
913860546 1:123774128-123774150 GTGGATATTCTGACATCTTGTGG + Intergenic
913860607 1:123775148-123775170 GTGGATATTCTGACATCTTGTGG + Intergenic
913860723 1:123777187-123777209 GTGGATATTCTGACATCTTGTGG + Intergenic
913860779 1:123778207-123778229 GTGGATATTCTGACATCTTGTGG + Intergenic
913860895 1:123780247-123780269 GTGGATATTCTGACATCTTGTGG + Intergenic
913860955 1:123781267-123781289 GTGGATATTCTGACATCTTGTGG + Intergenic
913861284 1:123787050-123787072 GTGGATATTCTGACATCTTGTGG + Intergenic
913861341 1:123788070-123788092 GTGGATATTCTGACATCTTGTGG + Intergenic
913861395 1:123789090-123789112 GTGGATATTCTGACATCTTGTGG + Intergenic
913861623 1:123793169-123793191 GTGGATATTCTGACATCTTGTGG + Intergenic
913861735 1:123795206-123795228 GTGGATATTCTGACATCTTGTGG + Intergenic
913861909 1:123798269-123798291 GTGGATATTCTGACATCTTGTGG + Intergenic
913862064 1:123801158-123801180 GTGGATATCCTGACATCTTGTGG + Intergenic
913862102 1:123801837-123801859 GTGGATATTCTGACATCTTGTGG + Intergenic
913862243 1:123804216-123804238 GTGGATATTCTGACATCTTGTGG + Intergenic
913862295 1:123805234-123805256 GTGGATATTCTGACATCTTGTGG + Intergenic
913862351 1:123806253-123806275 GTGGATATTCTGACATCTTGTGG + Intergenic
913862464 1:123808286-123808308 GTGGATATTCTGACATCTTGTGG + Intergenic
913862691 1:123812366-123812388 GTGGATATTCTGACATCTTGTGG + Intergenic
913862853 1:123815424-123815446 GTGGATATTCTGACATCTTGTGG + Intergenic
913862971 1:123817464-123817486 GTGGATATTCTGACATCTTGTGG + Intergenic
913863034 1:123818483-123818505 GTGGATATTCTGACATCTTGTGG + Intergenic
913863208 1:123821538-123821560 GTGGATATTCTGACATCTTGTGG + Intergenic
913863381 1:123824598-123824620 GTGGATAATCTGACATCTTGTGG + Intergenic
913863605 1:123828674-123828696 GTGGATATTCTGACATCTTGTGG + Intergenic
913863714 1:123830719-123830741 GTGGATATTCTGACATCTTGTGG + Intergenic
913863773 1:123831736-123831758 GTGGATATTCTGACATCTTGTGG + Intergenic
913863876 1:123833604-123833626 GTGGATATTCTGACATCTTGTGG + Intergenic
913863982 1:123835644-123835666 GTGGATATTCTGACATCTTGTGG + Intergenic
913864038 1:123836664-123836686 GTGGATATTCTGACATCTTGTGG + Intergenic
913864147 1:123838705-123838727 GTGGATATTCTGACATCTTGTGG + Intergenic
913864204 1:123839724-123839746 GTGGATATTCTGACATCTTGTGG + Intergenic
913864321 1:123841764-123841786 GTGGATATTCTGACATCTTGTGG + Intergenic
913864377 1:123842782-123842804 GTGGATATTCTGACATCTTGTGG + Intergenic
913864434 1:123843801-123843823 GTGGATATTCTGACATCTTGTGG + Intergenic
913864487 1:123844821-123844843 GTGGATATTCTGACATCTTGTGG + Intergenic
913864658 1:123847880-123847902 GTGGATATTCTGACATCTTGTGG + Intergenic
913864766 1:123849919-123849941 GTGGATATTCTGACATCTTGTGG + Intergenic
913864820 1:123850937-123850959 GTGGATATTCTGACATCTTGTGG + Intergenic
913864933 1:123852975-123852997 GTGGATATTCTGACATCTTGTGG + Intergenic
913865038 1:123855017-123855039 GTGGATATTCTGACATCTTGTGG + Intergenic
913865150 1:123857057-123857079 GTGGATATTCTGACATCTTGTGG + Intergenic
913865205 1:123858077-123858099 GTGGATATTCTGACATCTTGTGG + Intergenic
913865490 1:123863167-123863189 GTGGATATTCTGACATCTTGTGG + Intergenic
913865545 1:123864188-123864210 GTGGATATTCTGACATCTTGTGG + Intergenic
913865601 1:123865208-123865230 GTGGATATTCTGACATCTTGTGG + Intergenic
913866013 1:123872354-123872376 GTGGATATTCTGACATCTTGTGG + Intergenic
913866245 1:123876435-123876457 GTGGATATTCTGACATCTTGTGG + Intergenic
913866364 1:123878475-123878497 GTGGATATTCTGACATCTTGTGG + Intergenic
913866423 1:123879495-123879517 GTGGATATTCTGACATCTTGTGG + Intergenic
913866765 1:123885613-123885635 GTGGATATTCTGACATCTTGTGG + Intergenic
913866937 1:123888674-123888696 GTGGATATTCTGACATCTTGTGG + Intergenic
913866993 1:123889693-123889715 GTGGATATTCTGACATCTTGTGG + Intergenic
913867113 1:123891733-123891755 GTGGATATTCTGACATCTTGTGG + Intergenic
913867223 1:123893771-123893793 GTGGATATTCTGACATCTTGTGG + Intergenic
913867278 1:123894790-123894812 GTGGATATTCTGACATCTTGTGG + Intergenic
913867386 1:123896823-123896845 GTGGATATTCTGACATCTTGTGG + Intergenic
913867444 1:123897836-123897858 GTGGATATTCTGACATCTTGTGG + Intergenic
913867503 1:123898855-123898877 GTGGATATTCTGACATCTTGTGG + Intergenic
913867675 1:123901912-123901934 GTGGATATTCTGACATCTTGTGG + Intergenic
913867780 1:123903781-123903803 GTGGATATTCTGACATCTTGTGG + Intergenic
913868007 1:123907861-123907883 GTGGATATTCTGACATCTTGTGG + Intergenic
913868119 1:123909899-123909921 GTGGATATTCTGACATCTTGTGG + Intergenic
913868173 1:123910918-123910940 GTGGATATTCTGACATCTTGTGG + Intergenic
913868339 1:123913975-123913997 GTGGATATTCTGACATCTTGTGG + Intergenic
913868448 1:123916015-123916037 GTGGATATTCTGACATCTTGTGG + Intergenic
913868504 1:123917034-123917056 GTGGATATTCTGACATCTTGTGG + Intergenic
913868559 1:123918053-123918075 GTGGATATTCTGACATCTTGTGG + Intergenic
913868736 1:123921114-123921136 GTGGATATTCTGACATCTTTTGG + Intergenic
913868794 1:123922133-123922155 GTGGATATTCTGACATCTTGTGG + Intergenic
913868904 1:123924171-123924193 GTGGATATTCTGACATCTTGTGG + Intergenic
913868983 1:123925532-123925554 GTGGATATTCTGACATCTTGTGG + Intergenic
913869136 1:123928251-123928273 GTGGATATTCTGACATCTTGTGG + Intergenic
913869250 1:123930292-123930314 GTGGATATTCTGACATCTTGTGG + Intergenic
913869358 1:123932333-123932355 GTGGATATTCTGACATCTTGTGG + Intergenic
913869411 1:123933348-123933370 GTGGATATTCTGACATCTTGTGG + Intergenic
913869580 1:123936404-123936426 GTGGATATTCTGACATCTTGTGG + Intergenic
913869637 1:123937425-123937447 GTGGATATTCTGACATCTTGTGG + Intergenic
913869828 1:123940825-123940847 GTGGATATTCTGACATCTTGGGG + Intergenic
913869937 1:123942865-123942887 GTGGATATTCTGACATCTTGTGG + Intergenic
913870050 1:123944910-123944932 GTGGATATTCTGACATCTTGTGG + Intergenic
913870163 1:123946948-123946970 GTGGATATTCTGACATCTTGTGG + Intergenic
913870216 1:123947966-123947988 GTGGATATTCTGACATCTTGTGG + Intergenic
913870272 1:123948986-123949008 GTGGATATTCTGACATCTTGTGG + Intergenic
913870331 1:123950006-123950028 GTGGATATTCTGACATCTTGTGG + Intergenic
913870385 1:123951025-123951047 GTGGATATTCTGACATCTTGTGG + Intergenic
913870623 1:123955102-123955124 GTGGATATTCTGACATCTTGTGG + Intergenic
913871093 1:123963259-123963281 GTGGATATTCTGACATCTTGTGG + Intergenic
913871153 1:123964277-123964299 GTGGATATTCTGACATCTTGTGG + Intergenic
913871224 1:123965636-123965658 GTGGATATTCTGACATCTTGTGG + Intergenic
913871338 1:123967675-123967697 GTGGATATTCTGACATCTTGTGG + Intergenic
913871389 1:123968694-123968716 GTGGATATTCTGACATCTTGTGG + Intergenic
913871668 1:123973795-123973817 GTGGATATTCTGACATCTTGTGG + Intergenic
913871776 1:123975833-123975855 GTGGATATTCTGACATCTTGTGG + Intergenic
913871834 1:123976852-123976874 GTGGATATTCTGACATCTTGTGG + Intergenic
913872173 1:123982977-123982999 GTGGATATTCTGACATCTTGTGG + Intergenic
913872226 1:123983997-123984019 GTGGATATTCTGACATCTTGTGG + Intergenic
913872285 1:123985012-123985034 GTGGATATTCTGACATCTTGTGG + Intergenic
913872357 1:123986371-123986393 GTGGATATTCTGACATCTTGTGG + Intergenic
913872412 1:123987390-123987412 GTGGATATTCTGACATCTTGTGG + Intergenic
913872468 1:123988405-123988427 GTGGATATTCTGACATCTTGTGG + Intergenic
913872526 1:123989425-123989447 GTGGATATTCTGACATCTTGTGG + Intergenic
913872754 1:123993500-123993522 GTGGATATTCTGACATCTTTTGG + Intergenic
913872926 1:123996560-123996582 GTGGATATTCTGACATCTTGTGG + Intergenic
913873037 1:123998601-123998623 GTGGATATTCTGACATCTTGTGG + Intergenic
913873204 1:124001658-124001680 GTGGATATTCTGACATCTTCTGG + Intergenic
913873374 1:124004719-124004741 GTGGATATTCTGACATCTTGTGG + Intergenic
913873546 1:124007778-124007800 GTGGATATTCTGACATCTTGTGG + Intergenic
913873715 1:124010837-124010859 GTGGATATTCTGACATCTTGTGG + Intergenic
913873878 1:124013896-124013918 GTGGATATTCTGACATCTTGTGG + Intergenic
913874054 1:124016959-124016981 GTGGATATTCTGACATCTTGTGG + Intergenic
913874109 1:124017978-124018000 GTGGATATTCTGACATCTTGTGG + Intergenic
913874165 1:124018996-124019018 GTGGATATTCTGACATCTTGTGG + Intergenic
913874334 1:124022059-124022081 GTGGATATTCTGACATCTTGTGG + Intergenic
913874388 1:124023075-124023097 GTGGATATTCTGACATCTTGTGG + Intergenic
913874444 1:124024093-124024115 GTGGATATTCTGACATCTTGTGG + Intergenic
913874501 1:124025115-124025137 GTGGATATTCTGACATCTTGTGG + Intergenic
913874558 1:124026134-124026156 GTGGATATTCTGACATCTTGTGG + Intergenic
913874616 1:124027153-124027175 GTGGATATTCTGACATCTTTTGG + Intergenic
913874728 1:124029188-124029210 GTGGATATTCTGACATCTTGTGG + Intergenic
913874967 1:124033263-124033285 GTGGATATTCTGACATCTTGTGG + Intergenic
913875080 1:124035304-124035326 GTGGATATTCTGACATCTTGTGG + Intergenic
913875197 1:124037343-124037365 GTGGATATTCTGACATCTTGTGG + Intergenic
913875423 1:124041419-124041441 GTGGATATTCTGACATCTTGTGG + Intergenic
913875482 1:124042431-124042453 GTGGATATTCTGACATCTTGTGG + Intergenic
913875774 1:124047532-124047554 GTGGATATTCTGACATCTTGTGG + Intergenic
913876120 1:124053677-124053699 GTGGATATTCTGACATCTTGTGG + Intergenic
913876347 1:124057759-124057781 GTGGATATTCTGACATCTTGTGG + Intergenic
913876454 1:124059797-124059819 GTGGATATTCTGACATCTTGTGG + Intergenic
913876513 1:124060817-124060839 GTGGATATTCTGACATCTTGTGG + Intergenic
913876743 1:124064896-124064918 GTGGATATTCTGACATCTTGTGG + Intergenic
913876800 1:124065915-124065937 GTGGATATTCTGACATCTTGTGG + Intergenic
913876862 1:124066935-124066957 GTGGATATTCTGACATCTTGTGG + Intergenic
913877263 1:124074069-124074091 GTGGATATTCTGACATCTTGTGG + Intergenic
913877319 1:124075088-124075110 GTGGATATTCTGACATCTTGTGG + Intergenic
913877375 1:124076108-124076130 GTGGATATTCTGACATCTTGTGG + Intergenic
913877432 1:124077127-124077149 GTGGATATTCTGACATCTTGTGG + Intergenic
913877536 1:124079165-124079187 GTGGATATTCTGACATCTTGTGG + Intergenic
913877652 1:124081205-124081227 GTGGATATCCTGACATCTTGTGG + Intergenic
913877709 1:124082223-124082245 GTGGATATTCTGACATCTTGTGG + Intergenic
913877766 1:124083242-124083264 GTGGATATTCTGACATCTTGTGG + Intergenic
913877821 1:124084261-124084283 GTGGATATTCTGACATCTTGTGG + Intergenic
913877945 1:124086302-124086324 GTGGATATTCTGACATCTTGTGG + Intergenic
913878066 1:124088341-124088363 GTGGATATTCTGACATCTTGTGG + Intergenic
913878184 1:124090379-124090401 GTGGATATTCTGACATCTTGTGG + Intergenic
913878242 1:124091397-124091419 GTGGATATTCCGACATCTTTTGG + Intergenic
913878376 1:124093777-124093799 GTGGATATTCTGACATCTTGTGG + Intergenic
913878727 1:124099898-124099920 GTGGATATTCTGACATCTTGTGG + Intergenic
913878769 1:124100577-124100599 GTGGATATTCTGACATCTTGTGG + Intergenic
913878789 1:124100916-124100938 GTGGATATTCTGACATCTTGTGG + Intergenic
913878961 1:124103975-124103997 GTGGATATTCTGACATCTTGTGG + Intergenic
913879136 1:124107034-124107056 GTGGATATTCTGACATCTTGTGG + Intergenic
913879313 1:124110055-124110077 GTGGATATTCTGACATCTTGTGG + Intergenic
913879371 1:124111071-124111093 GTGGATATTCTGACATCTTGTGG + Intergenic
913879483 1:124113104-124113126 GTGGATATTCTGACATCTTGTGG + Intergenic
913879693 1:124117185-124117207 GTGGATATTCTGACATCTTGTGG + Intergenic
913879747 1:124118204-124118226 GTGGATATTCTGACATCTTGTGG + Intergenic
913879863 1:124120244-124120266 GTGGATATTCTGACATCTTGTGG + Intergenic
913879918 1:124121255-124121277 GTGGATATTCTGACATCTTGTGG + Intergenic
913879974 1:124122274-124122296 GTGGATATTCTGACATCTTGTGG + Intergenic
913880204 1:124126355-124126377 GTGGATATTCTGACATCTTGTGG + Intergenic
913880260 1:124127372-124127394 GTGGATATTCTGACATCTTGTGG + Intergenic
913880546 1:124132475-124132497 GTGGATATTCTGACATCTTGTGG + Intergenic
913880710 1:124135526-124135548 GTGGATATTCTGACATCTTCTGG + Intergenic
913880764 1:124136545-124136567 GTGGATATTCTGACATCTTGTGG + Intergenic
913880982 1:124140625-124140647 GTGGATAATCTGACATCTTGTGG + Intergenic
913881041 1:124141645-124141667 GTGGATATTCTGACATCTTGTGG + Intergenic
913881155 1:124143685-124143707 GTGGATATTCTGACATCTTGTGG + Intergenic
913881211 1:124144704-124144726 GTGGATATTCTGACATCTTGTGG + Intergenic
913881332 1:124146743-124146765 GTGGATATTCTGACATCTTGTGG + Intergenic
913881386 1:124147762-124147784 GTGGATATTCTGACATCTTGTGG + Intergenic
913881501 1:124149797-124149819 GTGGATATTCTGACATCTTGTGG + Intergenic
913881727 1:124153877-124153899 GTGGATATTCTGACATCTTGTGG + Intergenic
913881782 1:124154896-124154918 GTGGATATTCTGACATCTTGTGG + Intergenic
913881844 1:124155915-124155937 GTGGATATTCTGACATCTTGGGG + Intergenic
913881954 1:124157954-124157976 GTGGATATTCTGACATCTTGTGG + Intergenic
913882063 1:124159990-124160012 GTGAATGTTCTGACATCTTGTGG + Intergenic
913882120 1:124161010-124161032 GTGGATATTCTGACATCTTGTGG + Intergenic
913882179 1:124162029-124162051 GTGGATATTCTGACATCTTGTGG + Intergenic
913882400 1:124166102-124166124 GTGGATATTCTGACATCTTGTGG + Intergenic
913882574 1:124169129-124169151 GTGGATATCCTGACATCTTGTGG + Intergenic
913882627 1:124170149-124170171 GTGGATATTCTGACATCTTGTGG + Intergenic
913882738 1:124172188-124172210 GTGGATATTCTGACATCTTGTGG + Intergenic
913882916 1:124175250-124175272 GTGGATATTCTGACATCTTGTGG + Intergenic
913882969 1:124176269-124176291 GTGGATATTCTGACATCTTGTGG + Intergenic
913883020 1:124177288-124177310 GTGGATATTCTGACATCTTGTGG + Intergenic
913883132 1:124179326-124179348 GTGGATATTCTGACATCTTGTGG + Intergenic
913883191 1:124180347-124180369 GTGGATATTCTGACATCTTGTGG + Intergenic
913883301 1:124182382-124182404 GTGGATATTCTGACATCTTGTGG + Intergenic
913883471 1:124185438-124185460 GTGGATATTCTGACATCTTGTGG + Intergenic
913883525 1:124186457-124186479 GTGGATATTCTGACATCTTGTGG + Intergenic
913883700 1:124189518-124189540 GTGGATATTCTGACATCTTGTGG + Intergenic
913883761 1:124190539-124190561 GTGGATATTCTGACATCTTGTGG + Intergenic
913883880 1:124192580-124192602 GTGGATATTCTGACATCTTGTGG + Intergenic
913883935 1:124193601-124193623 GTGGATATTCTGACATCTTGTGG + Intergenic
913884053 1:124195642-124195664 GTGGATATTCTGACATCTTGTGG + Intergenic
913884227 1:124198700-124198722 GTGGATATTCTGACATCTTGTGG + Intergenic
913884404 1:124201760-124201782 GTGGATATTCTGACATCTTGTGG + Intergenic
913884864 1:124209923-124209945 GTGGATATTCTGACATCTTGTGG + Intergenic
913885094 1:124214004-124214026 GTGGATATTCTGACATCTTGTGG + Intergenic
913885206 1:124216043-124216065 GTGGATATTCTGACATCTTGTGG + Intergenic
913885315 1:124218083-124218105 GTGGATATTCTGACATCTTGTGG + Intergenic
913885496 1:124221139-124221161 GTGGATATTCTGACATCTTGTGG + Intergenic
913885668 1:124224197-124224219 GTGGATATTCTGACATTTTTTGG + Intergenic
913885893 1:124228276-124228298 GTGGATATTCTGACATCTTGTGG + Intergenic
913886160 1:124233374-124233396 GTGGATATTCTGACATCTTGTGG + Intergenic
913886278 1:124235416-124235438 GTGGATATTCTGACATCTTGTGG + Intergenic
913886337 1:124236435-124236457 GTGGATATTCTGACATCTTGTGG + Intergenic
913886394 1:124237456-124237478 GTGGATATTCTGACATCTTGTGG + Intergenic
913886451 1:124238475-124238497 GTGGATATTCTGACATCTTGTGG + Intergenic
913886622 1:124241534-124241556 GTGGATATTCTGACATCTTGTGG + Intergenic
913886673 1:124242553-124242575 GTGGATATTCTGACATCTTGTGG + Intergenic
913886846 1:124245610-124245632 GTGGATATTCTGACATCTTGTGG + Intergenic
913887188 1:124251722-124251744 GTGGATATTCTGACATCTTGTGG + Intergenic
913887361 1:124254781-124254803 GTGGATATTCTGACATCTTGTGG + Intergenic
913887477 1:124256813-124256835 GTGGATATTCTGACATCTTGTGG + Intergenic
913887524 1:124257663-124257685 GTGGATATTCTGACATCTTGTGG + Intergenic
913887582 1:124258684-124258706 GTGGATATTCTGACATCTTGTGG + Intergenic
913887641 1:124259703-124259725 GTGGATATTCTGACATCTTGTGG + Intergenic
913887700 1:124260722-124260744 GTGGATATTCTGACATCTTGTGG + Intergenic
913887877 1:124263784-124263806 GTGGATATTCTGACATCTTGTGG + Intergenic
913887933 1:124264803-124264825 GTGGATATTCTGACATCTTGTGG + Intergenic
913888049 1:124266838-124266860 GTGGATATTCTGACATCTTGTGG + Intergenic
913888223 1:124269896-124269918 GTGGATATTCTGACATCTTGTGG + Intergenic
913888282 1:124270916-124270938 GTGGATATTCTGACATCTTGTGG + Intergenic
913888339 1:124271939-124271961 GTGGATATTCTGACATCTTGTGG + Intergenic
913888356 1:124272279-124272301 GTGCATATTCTGACATCTTGAGG + Intergenic
913888449 1:124273979-124274001 GTGGATATTCTGACATCTTGTGG + Intergenic
913888617 1:124277036-124277058 GTGGATATTCTGACATCTTTTGG + Intergenic
913888674 1:124278056-124278078 GTGGATATTCTGACATCTTGTGG + Intergenic
913888848 1:124281118-124281140 GTGGATATTCTGACATCTTGTGG + Intergenic
913888963 1:124283156-124283178 GTGGATATTCTGACATCTTGTGG + Intergenic
913889130 1:124286210-124286232 GTGGATATTCTGACATCTTGTGG + Intergenic
913889305 1:124289273-124289295 GTGGATATTCTGACATCTTGTGG + Intergenic
913889701 1:124296415-124296437 GTGGATATTCTGACATCTTGTGG + Intergenic
913889819 1:124298454-124298476 GTGGATATTCTGACATCTTGTGG + Intergenic
913889938 1:124300496-124300518 GTGGATATTCTGACATCTTGTGG + Intergenic
913890105 1:124303556-124303578 GTGGATATTCTGACATCTTGTGG + Intergenic
913890398 1:124308656-124308678 GTGGATATTCTGACATCTTGTGG + Intergenic
913890508 1:124310696-124310718 GTGGATATTCTGACATCTTGTGG + Intergenic
913890562 1:124311716-124311738 GTGGATATTCTGACATCTTGTGG + Intergenic
913890610 1:124312734-124312756 GTGGATATTCTGACATCTTGTGG + Intergenic
913890836 1:124316815-124316837 GTGGATACTCTGACATCTTGTGG + Intergenic
913890890 1:124317836-124317858 GTGGATATTCTGACATCTTGTGG + Intergenic
913890946 1:124318856-124318878 GTGGATATTCTGACATCTTGTGG + Intergenic
913891004 1:124319875-124319897 GTGGATATTCTGACATCTTGTGG + Intergenic
913891165 1:124322938-124322960 GTGGATATTCTGACATCTTGTGG + Intergenic
913891273 1:124324979-124325001 GTGGATATTCTGACATCTTGTGG + Intergenic
913891499 1:124329057-124329079 GTGGATATTCTGACATCTTGTGG + Intergenic
913891612 1:124331098-124331120 GTGGATATTCTGACATCTTGTGG + Intergenic
913891669 1:124332118-124332140 GTGGATATTCTGACATCTTGTGG + Intergenic
913891963 1:124337218-124337240 GTGGATATTCTGACATCTTGTGG + Intergenic
913892077 1:124339256-124339278 GTGGATATTCTGACATCTTGTGG + Intergenic
913892184 1:124341295-124341317 GTGGATATTCTGACATCTTGTGG + Intergenic
913892527 1:124347419-124347441 GTGGATATTCTGACATCTTCTGG + Intergenic
913892703 1:124350480-124350502 GTGGATATTCTGACATCTTGTGG + Intergenic
913892885 1:124353541-124353563 GTGGATATTCTGACATCTTGTGG + Intergenic
913893352 1:124361697-124361719 GTGGATATTCTGACATCTTGTGG + Intergenic
913893409 1:124362717-124362739 GTGGATATTCTGACATCTTGTGG + Intergenic
913893637 1:124366804-124366826 GTGGATATTCTGACATCTTGTGG + Intergenic
913893860 1:124370885-124370907 GTGGATATTCTGACATCTTGTGG + Intergenic
913893919 1:124371904-124371926 GTGGATATTCTGACATCTTGTGG + Intergenic
913893970 1:124372923-124372945 GTGGATATTCTGACATCTTGTGG + Intergenic
913894030 1:124373943-124373965 GTGGATATTCTGACATCTTGTGG + Intergenic
913894144 1:124375982-124376004 GTGGATATTCTGACATCTTGTGG + Intergenic
913894202 1:124377001-124377023 GTGGATATTCTGACATCTTGTGG + Intergenic
913894316 1:124379041-124379063 GTGGATATTCTGACATCTTGTGG + Intergenic
913894649 1:124385157-124385179 GTGGATATTCTGACATCTTGTGG + Intergenic
913894697 1:124386007-124386029 GTGGATATTCTGACATCTTGTGG + Intergenic
913894751 1:124387025-124387047 GTGGATATTCTGACATCTTGTGG + Intergenic
913894806 1:124388045-124388067 GTGGATATTCTGACATCTTGTGG + Intergenic
913894865 1:124389066-124389088 GTGGATATTCTGACATCTTGTGG + Intergenic
913894979 1:124391107-124391129 GTGGATATTCTGACATCTTGTGG + Intergenic
913895156 1:124394166-124394188 GTGGATATTCTGACATCTTGTGG + Intergenic
913895209 1:124395186-124395208 GTGGATATTCTGACATCTTGTGG + Intergenic
913895374 1:124398244-124398266 GTGGATATTCTGACATCTTGTGG + Intergenic
913895432 1:124399263-124399285 GTGGATATTCTGACATCTTGTGG + Intergenic
913895605 1:124402324-124402346 GTGGATATTCTGACATCTTGTGG + Intergenic
913895659 1:124403342-124403364 GTGGATATTCTGACATCTTGTGG + Intergenic
913895948 1:124408446-124408468 GTGGATATTCTGACATCTTGTGG + Intergenic
913896006 1:124409465-124409487 GTGGATATTCTGACATCTTGTGG + Intergenic
913896061 1:124410484-124410506 GTGGATATTCTGACATCTTGCGG + Intergenic
913896119 1:124411500-124411522 GTGGATATTCTGACATCTTGTGG + Intergenic
913896173 1:124412520-124412542 GTGGATATTCTGACATCTTGTGG + Intergenic
913896281 1:124414564-124414586 GTGGATATTCTGACATCTTGTGG + Intergenic
913896340 1:124415582-124415604 GTGGATATTCTGACATCTTGTGG + Intergenic
913896451 1:124417617-124417639 GTGGATATTCTGACATCTTGTGG + Intergenic
913896508 1:124418636-124418658 GTGGATATTCTGACATCTTGTGG + Intergenic
913896568 1:124419655-124419677 GTGGATATTCTGACATCTTGTGG + Intergenic
913896901 1:124425775-124425797 GTGGATATTCTGACATCTTGTGG + Intergenic
913896955 1:124426794-124426816 GTGGATATTCTGACATCTTGTGG + Intergenic
913897016 1:124427813-124427835 GTGGATATACTGACATCTTGTGG + Intergenic
913897074 1:124428832-124428854 GTGGATATTCTGACATCTTGTGG + Intergenic
913897184 1:124430872-124430894 GTGGATATTCTGACATCTTGTGG + Intergenic
913897245 1:124431892-124431914 GTGGATATTCTGACATCTTGTGG + Intergenic
913897474 1:124435973-124435995 GTGGATATTCTGACATCTTGTGG + Intergenic
913897511 1:124436652-124436674 GTGGATATTCTGACATCTTGTGG + Intergenic
913897761 1:124441071-124441093 GTGGATATTCTGACATCTTGTGG + Intergenic
913897820 1:124442091-124442113 GTGCATATTCTGACATCTTGTGG + Intergenic
913897940 1:124444132-124444154 GTGGATATTCTGACATCTTGTGG + Intergenic
913897958 1:124444471-124444493 GTGGATATTCAGACATCTTTGGG + Intergenic
913897997 1:124445151-124445173 GTGGATATTCTGACATCTTGTGG + Intergenic
913898113 1:124447192-124447214 GTGGATATTCTGACATCTTGTGG + Intergenic
913898229 1:124449232-124449254 GTGGATATTCTGACATCTTGTGG + Intergenic
913898342 1:124451272-124451294 GTGGATATTCTGACATCTTGTGG + Intergenic
913898455 1:124453311-124453333 GTGGATATTCTGACATCTTGTGG + Intergenic
913898570 1:124455350-124455372 GTGGATATTCTGACATCTTGTGG + Intergenic
913898627 1:124456371-124456393 GTGGATATTCTGACATCTTGTGG + Intergenic
913898683 1:124457390-124457412 GTGGATATTCTGACATCTTGTGG + Intergenic
913898736 1:124458410-124458432 GTGGATATTCTGACATCTTGTGG + Intergenic
913898854 1:124460448-124460470 GTGGATATTCTGACATCTTGTGG + Intergenic
913899030 1:124463507-124463529 GTGGATATTCTGACATCTTGTGG + Intergenic
913899199 1:124466565-124466587 GTGGATATTCTGACATCTTGTGG + Intergenic
913899429 1:124470646-124470668 GTGGATATTCTGACATCTTGTGG + Intergenic
913899720 1:124475744-124475766 GTGGATATTCTGACATCTTGTGG + Intergenic
913899779 1:124476763-124476785 GTGGATATTCTGACATCTTGTGG + Intergenic
913899949 1:124479823-124479845 GTGGATATTCTGACATCTTGTGG + Intergenic
913900003 1:124480843-124480865 GTGGATATTCTGACATCTTGTGG + Intergenic
913900176 1:124483900-124483922 GTGGATATTCTGACATCTTGTGG + Intergenic
913900230 1:124484919-124484941 GTGGATATTCTGACATCTTGTGG + Intergenic
913900285 1:124485939-124485961 GTGGATATTCTGACATCTTGTGG + Intergenic
913900400 1:124487978-124488000 GTGGATATTCTGACATCTTGTGG + Intergenic
913900456 1:124488995-124489017 GTGGATATTCTGACATCTTGTGG + Intergenic
913900515 1:124490016-124490038 GTGGATATTCTGACATCTTGTGG + Intergenic
913900625 1:124492055-124492077 GTGGATATTCTGACATCTTGTGG + Intergenic
913900676 1:124493075-124493097 GTGGATATTCTGACATCTTGTGG + Intergenic
913900732 1:124494095-124494117 GTGGATATTCTGACATCTTGTGG + Intergenic
913900788 1:124495114-124495136 GTGGATATTCTGACATCTTGTGG + Intergenic
913901170 1:124501907-124501929 GTGGATATTCTGACATCTTGTGG + Intergenic
913901188 1:124502246-124502268 GTGGATATTCTGACATCTTGTGG + Intergenic
913901242 1:124503267-124503289 GTGGATATTCTGACATCTTGTGG + Intergenic
913901299 1:124504286-124504308 GTGGATATTCTGACATCTTGTGG + Intergenic
913901409 1:124506325-124506347 GTGGATATTCTGACATCTTGTGG + Intergenic
913901460 1:124507345-124507367 GTGGATATTCTGACATCTTGTGG + Intergenic
913901533 1:124508703-124508725 GTGGATATTCTGACATCTTGGGG + Intergenic
913902158 1:124519922-124519944 GTGGATATTCTGACATCTTGTGG + Intergenic
913902213 1:124520940-124520962 GTGGATATTCTGACATCTTGTGG + Intergenic
913902379 1:124523996-124524018 GTGGATATTCTGACATCTTGTGG + Intergenic
913902498 1:124526034-124526056 GTGGATATTCTGACATCTTGTGG + Intergenic
913902554 1:124527049-124527071 GTGGATATTCTGACATCTTGTGG + Intergenic
913902729 1:124530107-124530129 GTGGATATTCTGACATCTTGTGG + Intergenic
913903006 1:124535203-124535225 GTGGATATTCTGACATCTTGTGG + Intergenic
913903233 1:124539280-124539302 GTGGATATTCTGACATCTTGTGG + Intergenic
913903289 1:124540300-124540322 GTGGATATTCTGACATCTTGTGG + Intergenic
913903343 1:124541319-124541341 GTGGATATTCTGACATCTTGTGG + Intergenic
913903457 1:124543359-124543381 GTGGATATTCTGACATCTTGTGG + Intergenic
913903572 1:124545399-124545421 GTGGATATTCTGACATCTTGTGG + Intergenic
913903690 1:124547438-124547460 GTGGATATTCTGACATCTTGTGG + Intergenic
913903750 1:124548457-124548479 GTGGATATTCTGACATCTTGTGG + Intergenic
913903932 1:124551858-124551880 GTGGATATTCTGACATCTTGTGG + Intergenic
913904332 1:124558988-124559010 GTGGATATTCTGACATCTTGTGG + Intergenic
913904392 1:124560007-124560029 GTGGATATTCTGACATCTTGTGG + Intergenic
913904541 1:124562729-124562751 GTGGATATTCTGACATCTTGTGG + Intergenic
913904787 1:124567150-124567172 GTGGATATTCTGACATCTTGTGG + Intergenic
913904838 1:124568171-124568193 GTGGATATTCTGACATCTTGTGG + Intergenic
913904895 1:124569191-124569213 GTGGATATTCTGACATCTTGTGG + Intergenic
913905066 1:124572254-124572276 GTGGATATTCTGACATCTTGTGG + Intergenic
913905121 1:124573275-124573297 GTGGATATTCTGACATCTTGTGG + Intergenic
913905179 1:124574294-124574316 GTGGATATTCTGACATCTTGTGG + Intergenic
913905232 1:124575313-124575335 GTGGATATTCTGACATCTTGTGG + Intergenic
913905349 1:124577353-124577375 GTGGATATTCTGACATCTTGTGG + Intergenic
913905463 1:124579393-124579415 GTGGATATTCTGACATCTTGTGG + Intergenic
913905577 1:124581433-124581455 GTGGATATTCTGACATCTTGTGG + Intergenic
913905747 1:124584491-124584513 GTGGATATTCTGACATCTTGTGG + Intergenic
913905863 1:124586529-124586551 GTGGATATTCTGACATCTTGTGG + Intergenic
913905924 1:124587548-124587570 GTGGATATTCTGACATCTTGTGG + Intergenic
913906041 1:124589587-124589609 GTGGATATTCTGACATCTTGTGG + Intergenic
913906214 1:124592649-124592671 GTGGATATTCTGACATCTTGTGG + Intergenic
913906274 1:124593669-124593691 GTGGATATTCTGACATCTTGTGG + Intergenic
913906333 1:124594690-124594712 GTGGATATTCTGACATCTTGTGG + Intergenic
913906394 1:124595709-124595731 GTGGATATTCTGACATCTTGTGG + Intergenic
913906560 1:124598767-124598789 GTGGATATTCTGACATCTTGTGG + Intergenic
913906616 1:124599787-124599809 GTGGATATTCTGACATCTTGTGG + Intergenic
913906671 1:124600806-124600828 GTGGATATTCTGACATCTTGTGG + Intergenic
913907127 1:124608962-124608984 GTGGATATTCTGACATCTTGTGG + Intergenic
913907186 1:124609981-124610003 GTGGATATTCTGACATCTTGTGG + Intergenic
913907242 1:124611002-124611024 GTGGATATTCTGACATCTTGTGG + Intergenic
913907299 1:124612022-124612044 GTGGATATTCTGACATCTTGTGG + Intergenic
913907414 1:124614061-124614083 GTGGATATTCTGACATCTTGTGG + Intergenic
913907637 1:124618139-124618161 GTGGATATTCTGACATCTTGTGG + Intergenic
913907749 1:124620178-124620200 GTGGATATTCTGACATCTTGTGG + Intergenic
913908033 1:124625277-124625299 GTGGATATTCTGACATCTTGTGG + Intergenic
913908091 1:124626296-124626318 GTGGATATTCTGACATCTTGTGG + Intergenic
913908258 1:124629356-124629378 GTGGATATTCTGACATCTTGTGG + Intergenic
913908428 1:124632416-124632438 GTGGATATTCTGACATCTTGTGG + Intergenic
913908542 1:124634456-124634478 GTGGATATTCTGACATCTTGTGG + Intergenic
913908697 1:124637175-124637197 GTGGATATTCTGACATCTTGTGG + Intergenic
913909041 1:124643300-124643322 GTGGATATTCTGACATCTTGTGG + Intergenic
913909094 1:124644318-124644340 GTGGATATTCTGACATCTTGTGG + Intergenic
913909157 1:124645336-124645358 GTGGATATTCTGACATCTTGTGG + Intergenic
913909209 1:124646355-124646377 GTGGATATTCTGACATCTTGTGG + Intergenic
913909433 1:124650434-124650456 GTGGATACTCTGACATCATGTGG + Intergenic
913909487 1:124651452-124651474 GTGGATATTCTGACATCTTGTGG + Intergenic
913909664 1:124654514-124654536 GTGGATATTCTGACATCTTGTGG + Intergenic
913909782 1:124656555-124656577 GTGGATATTCTGACATCTTGTGG + Intergenic
913909844 1:124657575-124657597 GTGGATATTCTGACATCTTGTGG + Intergenic
913909896 1:124658594-124658616 GTGGATATTCTGACATCTTGTGG + Intergenic
913909949 1:124659611-124659633 GTGGATATTCTGACATCTTGTGG + Intergenic
913910062 1:124661652-124661674 GTGGATATTCTGACATCTTGTGG + Intergenic
913910117 1:124662669-124662691 GTGGATATCCTGACATCTTGTGG + Intergenic
913910176 1:124663687-124663709 GTGGATATTCTGACATCTTGTGG + Intergenic
913910410 1:124667774-124667796 GTGGATATTCTGACATCTTGTGG + Intergenic
913910467 1:124668793-124668815 GTGGATATTCTGACATCTTGTGG + Intergenic
913910522 1:124669813-124669835 GTGGATATTCTGACATCTTGTGG + Intergenic
913910580 1:124670833-124670855 GTGGATATTCTGACATCTTGTGG + Intergenic
913910746 1:124673895-124673917 GTGGATATTCTGACATCTTGTGG + Intergenic
913910805 1:124674912-124674934 GTGGATATTCTGACATCTTGTGG + Intergenic
913910864 1:124675932-124675954 GTGGATATTCTGACATCTTGTGG + Intergenic
913911028 1:124678992-124679014 GTGGATATTCTGACATCTTGTGG + Intergenic
913911081 1:124680011-124680033 GTGGATATTCTGACATCTTGTGG + Intergenic
913911194 1:124682051-124682073 GTGGATATTCTGACATCTTGTGG + Intergenic
913911360 1:124685106-124685128 GTGGATATTCTGACATCTTGTGG + Intergenic
913911420 1:124686125-124686147 GTGGATATTCTGACATCTTGTGG + Intergenic
913911538 1:124688168-124688190 GTGGATATTCTGACATCTTGTGG + Intergenic
913911996 1:124696326-124696348 GTGGATATTCTGACATCTTGTGG + Intergenic
913912054 1:124697345-124697367 GTGGATATTCTGACATCTTGTGG + Intergenic
913912170 1:124699384-124699406 GTGGATATTCTGACATCTTGTGG + Intergenic
913912335 1:124702444-124702466 GTGGATATTCTGACATCTTGTGG + Intergenic
913912391 1:124703464-124703486 GTGGATATTCTGACATCTTGTGG + Intergenic
913912447 1:124704480-124704502 GTGGATATTCTGACATCTTGTGG + Intergenic
913912571 1:124706520-124706542 GTGGATATTCTGATATCTTTTGG + Intergenic
913912629 1:124707539-124707561 GTGGATATTCTGACATCTTGTGG + Intergenic
913912688 1:124708559-124708581 GTGGATATTCTGACATCTTGTGG + Intergenic
913912802 1:124710600-124710622 GTGGATATTCTGACATCTTGTGG + Intergenic
913912969 1:124713665-124713687 GTGCATATTCTGACATCTTGTGG + Intergenic
913913195 1:124717737-124717759 GTGGATATTCTGACATCTTGTGG + Intergenic
913913481 1:124722835-124722857 GTGGATATTCTGACATCTTGTGG + Intergenic
913913819 1:124728957-124728979 GTGGATATTCTGACATCTTGTGG + Intergenic
913913876 1:124729976-124729998 GTGGATATTCTGACATCTTGTGG + Intergenic
913913935 1:124730994-124731016 GTGGATATTCTGACATCTTGTGG + Intergenic
913913992 1:124732014-124732036 GTGGATATTCTGACATCTTGTGG + Intergenic
913914311 1:124737793-124737815 GTGGATATTCTGACATCTTGTGG + Intergenic
913914385 1:124739151-124739173 GTGGATATTCTGACATCTTGTGG + Intergenic
913914443 1:124740170-124740192 GTGGATATTCTGACATCTTGTGG + Intergenic
913914501 1:124741189-124741211 GTGGATATTCTGACATCTTGTGG + Intergenic
913914615 1:124743231-124743253 GTGGATATTCTGACATCTTGTGG + Intergenic
913914672 1:124744250-124744272 GTGGATATTCTGACATCTTGTGG + Intergenic
913914726 1:124745269-124745291 GTGGATATTCTGACATCTTGTGG + Intergenic
913914786 1:124746288-124746310 GTGGATATTCTGACATCTTGTGG + Intergenic
913914955 1:124749348-124749370 GTGGATATTCTGACATCTTGTGG + Intergenic
913915058 1:124751382-124751404 GTGGATATTCTGACATCTTGTGG + Intergenic
913915115 1:124752401-124752423 GTGGATATTCTGACATCTTGTGG + Intergenic
913915238 1:124754440-124754462 GTGGATATTCTGACATCTTGTGG + Intergenic
913915359 1:124756479-124756501 GTGGATATTCTGACATCTTGTGG + Intergenic
913915524 1:124759543-124759565 GTGGATATTCTGACATCTTGTGG + Intergenic
913915582 1:124760561-124760583 GTGGATATTCTGACATCTTGTGG + Intergenic
913915635 1:124761581-124761603 GTGGATATTCTGACATCTTGTGG + Intergenic
913915694 1:124762601-124762623 GTGGATATTCTGACATCTTGTGG + Intergenic
913915922 1:124766674-124766696 GTGGATATTCTGACATCTTGTGG + Intergenic
913916088 1:124769735-124769757 GTGGATATTCTGACATCTTGTGG + Intergenic
913916145 1:124770755-124770777 GTGGATATTCTGACATCTTGTGG + Intergenic
913916204 1:124771774-124771796 GTGGATATTCTGACATCTTGTGG + Intergenic
913916320 1:124773810-124773832 GTGGATATTCTGACATCTTGTGG + Intergenic
913916431 1:124775848-124775870 GTGGATATTCTGACATCTTGTGG + Intergenic
913916482 1:124776867-124776889 GTGGATATTCTGACATCTTGTGG + Intergenic
913916536 1:124777886-124777908 GTGGATATTCTGACATCTTGTGG + Intergenic
913916659 1:124779923-124779945 GTGGATATTCTGACATCTTGTGG + Intergenic
913916945 1:124785028-124785050 GTGGATATTCTGACATCTTGTGG + Intergenic
915366494 1:155319795-155319817 ATGATTACCTTGACCTCTTTGGG + Exonic
917226830 1:172792531-172792553 GTTAATACCCTAACATTATTAGG - Intergenic
918697680 1:187563798-187563820 ATGATTACCTTGACCTCTTTGGG + Intergenic
919208472 1:194449754-194449776 ATGAATTACCTGTCATCTTTTGG + Intergenic
921633897 1:217468486-217468508 GTGCATTCCTTGACATTTTTTGG - Intronic
1065484930 10:26228309-26228331 GTGGAATCCCTGACAACTTTTGG + Intronic
1066046091 10:31596804-31596826 GAGAATACCCAGATATTTTTAGG + Intergenic
1068097961 10:52515700-52515722 TTGAGCACCCTGACATCTCTAGG + Intergenic
1069075044 10:64030471-64030493 GTGAATAACTTGTTATCTTTGGG + Intergenic
1071943965 10:90619632-90619654 GTGAGGACCTGGACATCTTTAGG + Intergenic
1074849894 10:117431287-117431309 GTGAATACCCATTCATTTTTGGG + Intergenic
1075015891 10:118909797-118909819 AGTAAGACCCTGACATCTTTGGG - Intergenic
1075811249 10:125226701-125226723 GAGAAAACACTGACCTCTTTAGG - Intergenic
1080239496 11:30110300-30110322 GTGAACACCCTAGCATCCTTTGG + Intergenic
1080786581 11:35480328-35480350 GTGATAACCCTGGCAACTTTGGG - Intronic
1082692025 11:56317555-56317577 GTGAATACCCTTATCTCTTCGGG - Intergenic
1086005804 11:82034081-82034103 ATTAAGACCCTGAAATCTTTAGG - Intergenic
1088458914 11:110062194-110062216 GTGAATAGAATGACATGTTTTGG - Intergenic
1089649868 11:119905746-119905768 GTGCATACCCTGACTCCTTCAGG - Intergenic
1090965009 11:131590902-131590924 GTGGATACCCAGTCATCATTTGG + Intronic
1093397406 12:18700212-18700234 GGGAATACACTGAGATCTTTAGG - Intronic
1095369891 12:41454529-41454551 TTGAATACCCAGGGATCTTTGGG + Intronic
1096584724 12:52612479-52612501 CTGGATAACTTGACATCTTTAGG - Intronic
1098078145 12:66755751-66755773 GTGAATTCCCTGACATTTCCAGG - Intronic
1099426232 12:82526546-82526568 ATTAATACTCTGACATTTTTAGG + Intergenic
1101212739 12:102550982-102551004 ATAAAAACACTGACATCTTTTGG - Intergenic
1101233494 12:102765659-102765681 CTGAATACCATGACGTCCTTAGG + Intergenic
1101369126 12:104108802-104108824 GTAAACACCCTGACATCTCTAGG - Intergenic
1104305278 12:127604788-127604810 CTGACCACCCTGACATTTTTAGG - Intergenic
1107249565 13:38342344-38342366 GTTAATACTCTGATAGCTTTGGG + Intergenic
1107250824 13:38360345-38360367 TTAGATACCCTGACATATTTGGG - Intronic
1109059897 13:57602085-57602107 TTGAAAACAGTGACATCTTTTGG - Intergenic
1110806264 13:79757667-79757689 GTGAATACCATGAGATCTGATGG - Intergenic
1111135871 13:84042999-84043021 TTCAATACCCAGACTTCTTTAGG - Intergenic
1111741126 13:92206901-92206923 GTGAAGACCATTCCATCTTTTGG - Intronic
1115083180 14:29481925-29481947 GTGAATAACTTGCCATGTTTGGG - Intergenic
1115259759 14:31439808-31439830 GTGAAAACCCTGACGCTTTTTGG + Intronic
1116056558 14:39871498-39871520 ATTAGTACCCAGACATCTTTGGG - Intergenic
1117351395 14:54885141-54885163 ATGATTACCTTGACCTCTTTGGG - Intronic
1118891085 14:69909697-69909719 GAAAATACCCTGACATTTTCTGG - Intronic
1122080076 14:99261023-99261045 GTGAACACCCTGTCATCTCAGGG - Intronic
1124172872 15:27392347-27392369 TTGATGACCCTGACATTTTTGGG + Intronic
1125875484 15:43140462-43140484 ATGATTACCCTCACCTCTTTGGG - Intronic
1126774301 15:52086712-52086734 GAGAATCCTCTGACATCTTGTGG + Intergenic
1131628746 15:94152886-94152908 GTTAGTACACTGACATCCTTGGG - Intergenic
1136147473 16:28323744-28323766 GTAAATACTCTGGCATCCTTTGG + Exonic
1142803196 17:2357909-2357931 GTGATGACCCTGACATTATTTGG - Intronic
1145226627 17:21134404-21134426 GTGAATTTCCTCACCTCTTTAGG + Intronic
1154327558 18:13402529-13402551 GTGAAAAACATTACATCTTTTGG + Intronic
1158915599 18:62124324-62124346 GGGAATACCATCAGATCTTTTGG - Intronic
1168199558 19:54804997-54805019 GTGAAAACCTCGACATCTGTAGG - Exonic
925092345 2:1166029-1166051 ATGAAGTCCCTGACATATTTTGG + Intronic
925145149 2:1577275-1577297 GTAAATATTCTGACATATTTGGG - Intergenic
926627297 2:15102923-15102945 CTGTATACCCTGACAAATTTTGG - Intergenic
927736907 2:25532349-25532371 GGGAATATCCTAACATCTTGGGG - Intronic
938218705 2:129546442-129546464 GTGAACACACTGATATCATTTGG - Intergenic
940442504 2:153734772-153734794 CTGATTACGCTGACATTTTTTGG + Intergenic
941086832 2:161127718-161127740 TTGAAGACCCTTACAGCTTTAGG + Intergenic
942847900 2:180447925-180447947 GTGAATATACTGAAAACTTTTGG + Intergenic
945729902 2:213520938-213520960 GTGACTTCCTTGACATTTTTGGG + Intronic
1168939583 20:1697253-1697275 GTGAATAGCATGACATCTCCAGG + Intergenic
1172980206 20:38935850-38935872 GTAACTATCTTGACATCTTTGGG - Intronic
1173991319 20:47305872-47305894 GTAAAGACCCTGACGTCATTTGG + Intronic
1174140340 20:48408618-48408640 GTGATTATCTTGACATATTTTGG - Intergenic
1182825467 22:33260961-33260983 TTGAAAACCCTGACATTTCTGGG - Intronic
949829585 3:8199541-8199563 GTGAATTCACTGAGATTTTTTGG - Intergenic
951109709 3:18787534-18787556 GTGCAGATCCTGATATCTTTAGG - Intergenic
955619407 3:60846617-60846639 TTGAATACCCTAATATCTGTAGG - Intronic
956667188 3:71653317-71653339 GTGAATGCCATGACATATTTGGG + Intergenic
959989924 3:112619637-112619659 ATGAATAGCTTGACTTCTTTTGG - Intronic
967667540 3:192191114-192191136 GTGACTACCCTGACATAATATGG + Intronic
967723058 3:192835794-192835816 GTGAAAAACCTGACCTCCTTTGG + Intronic
968052389 3:195664028-195664050 GTGAATATCTTGACTCCTTTAGG + Intergenic
968103423 3:195984312-195984334 GTGAATATCTTGACTCCTTTAGG - Intergenic
970270105 4:14337363-14337385 GTAAATATCCTAACTTCTTTGGG + Intergenic
973332956 4:48928240-48928262 GTGAATGTCCTGACCTATTTGGG + Intergenic
973807041 4:54536204-54536226 ATGAATACACGGACATCTTTGGG + Intergenic
974645843 4:64691174-64691196 GTCAATAACATGAAATCTTTTGG - Intergenic
976095189 4:81501187-81501209 ATGAATCTCCTGACATCTTCTGG + Intronic
976774962 4:88697968-88697990 GTTGCTACCCTGACATCTTCTGG + Exonic
980132610 4:128830708-128830730 CTGATCAACCTGACATCTTTAGG - Intronic
981354216 4:143768539-143768561 GTAAATAACTTAACATCTTTGGG + Intergenic
983576728 4:169269513-169269535 GTGAATCCCTAGATATCTTTAGG - Intronic
989585486 5:43071288-43071310 GTTAACACGCTGACATCTTTCGG + Intronic
989908471 5:47296865-47296887 GTGGATATTCTGACATCTTGTGG + Intergenic
989908565 5:47298555-47298577 GTGGATATTCTGACATCTTGTGG + Intergenic
989909559 5:49612467-49612489 GTGGATATTCTGACATCTTGTGG - Intergenic
989909678 5:49614506-49614528 GTGGATATTCTGACATCTTGTGG - Intergenic
989910210 5:49626718-49626740 GTGGATATTCTGACATCTTGTGG - Intergenic
989910303 5:49631050-49631072 GTGGATATTCTGACATCTTGTGG - Intergenic
989910893 5:49649492-49649514 GTGGATATTCTGACATCTTGTGG + Intergenic
995485560 5:112636764-112636786 GTAACTACCCTGACACCTTTTGG - Intergenic
996235300 5:121121656-121121678 GTGAATGCCCTGTGATGTTTAGG + Intergenic
998244773 5:140489593-140489615 GTAAATACTCTGAGATGTTTAGG + Intronic
1004189774 6:13453925-13453947 GTGAGGACTGTGACATCTTTTGG - Intronic
1008520721 6:52360673-52360695 GAGAGTTCCCTGACATCTTTGGG + Intergenic
1008526409 6:52411909-52411931 GTGAATACTTTCTCATCTTTAGG + Intergenic
1011377896 6:86710055-86710077 CTGGCTACCCTGACATCATTTGG + Intergenic
1018785421 6:167104323-167104345 GTCAGGACCTTGACATCTTTTGG + Intergenic
1020495677 7:8850340-8850362 TAGAATACCCTGTCATCTGTTGG + Intergenic
1026487042 7:70830514-70830536 ATGAATAGCCAGTCATCTTTTGG + Intergenic
1027313234 7:76968504-76968526 ATGATTACCTTGACTTCTTTGGG - Intergenic
1027518469 7:79171957-79171979 GTGTATGCCCTTACAGCTTTAGG + Intronic
1028956892 7:96703612-96703634 GTGAATAACCTTATAGCTTTAGG - Intronic
1030354107 7:108524264-108524286 GTGAATATCCTGAAATATTATGG - Intronic
1031418669 7:121523372-121523394 GAGAATATCCTCATATCTTTAGG - Intergenic
1035277393 7:157756024-157756046 CTGACTACCCTGACATTTTATGG + Intronic
1037209379 8:16367251-16367273 GTGAATACCCTGACATCTTTGGG - Intronic
1043138559 8:76558579-76558601 GTGAATACCCTGTCCTCATGTGG - Intergenic
1043751914 8:83948040-83948062 TTCAATACCCTGACAGGTTTTGG - Intergenic
1046254631 8:111680318-111680340 GTGAATACCCTTATGTCTGTGGG - Intergenic
1047063595 8:121255154-121255176 ATTAAGACACTGACATCTTTGGG - Intergenic
1047501460 8:125445064-125445086 GTGGAGACCCTTACCTCTTTTGG + Intergenic
1050330751 9:4543201-4543223 GTGAATACCAAGACTTATTTGGG - Intronic
1056432979 9:86547076-86547098 TTGAATACTCAGACATCTCTGGG - Intergenic
1060626175 9:125114120-125114142 GTAAATACGGTGACATCTGTCGG + Intronic
1203339035 Un_KI270304v1:1615-1637 GTGGATATTCTGACATCTTGTGG - Intergenic
1203340360 Un_KI270315v1:926-948 GTGGATATGCTGACATCTTGTGG + Intergenic
1188251703 X:27903877-27903899 GGGAATAGCCTAAAATCTTTGGG + Intergenic
1189776701 X:44476339-44476361 ATGATTACCTTGACCTCTTTGGG - Intergenic
1189853196 X:45197168-45197190 GTGATTACTATGACATCTTAGGG - Intronic
1190689668 X:52902872-52902894 GTTAGTTCCCTGACATCCTTTGG - Intronic
1190696315 X:52952920-52952942 GTTAGTTCCCTGACATCCTTTGG + Intronic