ID: 1037210757

View in Genome Browser
Species Human (GRCh38)
Location 8:16384312-16384334
Sequence GGGATTGCAGGCGTGAGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 9406
Summary {0: 1, 1: 13, 2: 191, 3: 3004, 4: 6197}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037210757_1037210764 4 Left 1037210757 8:16384312-16384334 CCACAGCTCACGCCTGCAATCCC 0: 1
1: 13
2: 191
3: 3004
4: 6197
Right 1037210764 8:16384339-16384361 CTTTGGCAGGCCAAGACAGGTGG 0: 6
1: 1611
2: 31245
3: 84062
4: 158256
1037210757_1037210760 -9 Left 1037210757 8:16384312-16384334 CCACAGCTCACGCCTGCAATCCC 0: 1
1: 13
2: 191
3: 3004
4: 6197
Right 1037210760 8:16384326-16384348 TGCAATCCCAGCACTTTGGCAGG 0: 36
1: 7139
2: 309803
3: 267648
4: 151005
1037210757_1037210763 1 Left 1037210757 8:16384312-16384334 CCACAGCTCACGCCTGCAATCCC 0: 1
1: 13
2: 191
3: 3004
4: 6197
Right 1037210763 8:16384336-16384358 GCACTTTGGCAGGCCAAGACAGG 0: 14
1: 3693
2: 70736
3: 189346
4: 233205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037210757 Original CRISPR GGGATTGCAGGCGTGAGCTG TGG (reversed) Intronic
Too many off-targets to display for this crispr