ID: 1037210760

View in Genome Browser
Species Human (GRCh38)
Location 8:16384326-16384348
Sequence TGCAATCCCAGCACTTTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 735631
Summary {0: 36, 1: 7139, 2: 309803, 3: 267648, 4: 151005}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037210754_1037210760 22 Left 1037210754 8:16384281-16384303 CCACATTATGAAACATAGGCTCA 0: 1
1: 0
2: 2
3: 15
4: 137
Right 1037210760 8:16384326-16384348 TGCAATCCCAGCACTTTGGCAGG 0: 36
1: 7139
2: 309803
3: 267648
4: 151005
1037210757_1037210760 -9 Left 1037210757 8:16384312-16384334 CCACAGCTCACGCCTGCAATCCC 0: 1
1: 13
2: 191
3: 3004
4: 6197
Right 1037210760 8:16384326-16384348 TGCAATCCCAGCACTTTGGCAGG 0: 36
1: 7139
2: 309803
3: 267648
4: 151005

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037210760 Original CRISPR TGCAATCCCAGCACTTTGGC AGG Intronic
Too many off-targets to display for this crispr