ID: 1037210763

View in Genome Browser
Species Human (GRCh38)
Location 8:16384336-16384358
Sequence GCACTTTGGCAGGCCAAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037210757_1037210763 1 Left 1037210757 8:16384312-16384334 CCACAGCTCACGCCTGCAATCCC No data
Right 1037210763 8:16384336-16384358 GCACTTTGGCAGGCCAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037210763 Original CRISPR GCACTTTGGCAGGCCAAGAC AGG Intronic