ID: 1037210763

View in Genome Browser
Species Human (GRCh38)
Location 8:16384336-16384358
Sequence GCACTTTGGCAGGCCAAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 496994
Summary {0: 14, 1: 3693, 2: 70736, 3: 189346, 4: 233205}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037210757_1037210763 1 Left 1037210757 8:16384312-16384334 CCACAGCTCACGCCTGCAATCCC 0: 1
1: 13
2: 191
3: 3004
4: 6197
Right 1037210763 8:16384336-16384358 GCACTTTGGCAGGCCAAGACAGG 0: 14
1: 3693
2: 70736
3: 189346
4: 233205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037210763 Original CRISPR GCACTTTGGCAGGCCAAGAC AGG Intronic
Too many off-targets to display for this crispr