ID: 1037210764

View in Genome Browser
Species Human (GRCh38)
Location 8:16384339-16384361
Sequence CTTTGGCAGGCCAAGACAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275180
Summary {0: 6, 1: 1611, 2: 31245, 3: 84062, 4: 158256}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037210757_1037210764 4 Left 1037210757 8:16384312-16384334 CCACAGCTCACGCCTGCAATCCC 0: 1
1: 13
2: 191
3: 3004
4: 6197
Right 1037210764 8:16384339-16384361 CTTTGGCAGGCCAAGACAGGTGG 0: 6
1: 1611
2: 31245
3: 84062
4: 158256
1037210759_1037210764 -8 Left 1037210759 8:16384324-16384346 CCTGCAATCCCAGCACTTTGGCA 0: 35
1: 7034
2: 305708
3: 263256
4: 146985
Right 1037210764 8:16384339-16384361 CTTTGGCAGGCCAAGACAGGTGG 0: 6
1: 1611
2: 31245
3: 84062
4: 158256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037210764 Original CRISPR CTTTGGCAGGCCAAGACAGG TGG Intronic
Too many off-targets to display for this crispr