ID: 1037211994

View in Genome Browser
Species Human (GRCh38)
Location 8:16400056-16400078
Sequence GATCCTACCTCCAACAGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 178}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037211994_1037211998 -6 Left 1037211994 8:16400056-16400078 CCCACACTGTTGGAGGTAGGATC 0: 1
1: 0
2: 0
3: 12
4: 178
Right 1037211998 8:16400073-16400095 AGGATCTGGTGGCAAGTGTTTGG No data
1037211994_1037212001 17 Left 1037211994 8:16400056-16400078 CCCACACTGTTGGAGGTAGGATC 0: 1
1: 0
2: 0
3: 12
4: 178
Right 1037212001 8:16400096-16400118 GCGCAGATCTCTCATGACCTGGG No data
1037211994_1037211999 -5 Left 1037211994 8:16400056-16400078 CCCACACTGTTGGAGGTAGGATC 0: 1
1: 0
2: 0
3: 12
4: 178
Right 1037211999 8:16400074-16400096 GGATCTGGTGGCAAGTGTTTGGG No data
1037211994_1037212000 16 Left 1037211994 8:16400056-16400078 CCCACACTGTTGGAGGTAGGATC 0: 1
1: 0
2: 0
3: 12
4: 178
Right 1037212000 8:16400095-16400117 GGCGCAGATCTCTCATGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037211994 Original CRISPR GATCCTACCTCCAACAGTGT GGG (reversed) Intronic
900458328 1:2787907-2787929 AATCCCACCTCCCACAGGGTAGG - Intronic
900899149 1:5505065-5505087 AATCCTAGCCCCAACAGTGATGG + Intergenic
901608409 1:10477008-10477030 AATCCTACCTCCACCAGCTTTGG - Intronic
903231953 1:21927467-21927489 GGTCCTGCCTCCTCCAGTGTAGG + Intronic
903352414 1:22725720-22725742 GAACATATCTCCAAAAGTGTGGG - Intronic
904143550 1:28371841-28371863 GATCCTCCCTCCCAAAGTGCTGG + Intronic
912427539 1:109608001-109608023 AATCCTACCTCAGACAGTATGGG - Exonic
913373567 1:118127557-118127579 GGCCCTGCCTCCAACAGTGGGGG + Intronic
914354107 1:146867073-146867095 GATCCTCCCTCCCCCAGGGTTGG - Intergenic
916962569 1:169904133-169904155 GGTCCCACCTCCAACACTGAGGG + Intergenic
918293773 1:183135633-183135655 GATCCTTCCTCCCGAAGTGTTGG - Intronic
918403978 1:184193268-184193290 ATTCCTACCTCAAACACTGTGGG - Intergenic
919230645 1:194769027-194769049 GACCCAACCTCCAACACTGGAGG + Intergenic
919472633 1:197998109-197998131 GGCCCTACCTCCAACATTGGAGG - Intergenic
919834705 1:201565767-201565789 GGTCCCACCTTCAACTGTGTGGG - Intergenic
921384818 1:214558022-214558044 GATCCTTCCTCCCCCAGTGAAGG - Intergenic
924859907 1:247910416-247910438 GATATTACCTCCAATATTGTGGG + Intergenic
1064399746 10:15011758-15011780 GATATTACTTCCAACAGTGTAGG + Intergenic
1064432218 10:15280969-15280991 GGCCCTACCTCCAACACTGGGGG - Intronic
1064584971 10:16830844-16830866 GATCCAACCTCCCAAAGTGCTGG - Intronic
1066001918 10:31112507-31112529 GACCCCACCTCCAACACTGGAGG + Intergenic
1067412580 10:46077961-46077983 GGTCCCACCTCCAACACTGGGGG - Intergenic
1068069924 10:52183151-52183173 GACCCCACCTCCAACATTGGAGG + Intronic
1070458479 10:76641764-76641786 GCTCCTACCTCCATCACTGGGGG - Intergenic
1071375211 10:84995415-84995437 GGGCCTACTTCCAACAGTGGAGG + Intergenic
1071717380 10:88110940-88110962 GAACCTTCCTCCAAAAGTGAAGG + Intergenic
1074111104 10:110423355-110423377 ACTCCCACCTCCAACAGGGTTGG - Intergenic
1075246393 10:120825757-120825779 GATTCTACCTCGGACAGTGATGG + Intergenic
1075859496 10:125662373-125662395 GAGCCAACCTCCAGCAATGTAGG + Intronic
1077349780 11:2087209-2087231 GACCCCACCTCCAACACTGGGGG - Intergenic
1079205512 11:18411261-18411283 GATCCGCCCTCCCAAAGTGTTGG - Intergenic
1079861243 11:25674390-25674412 GGTCCCACCTCCAACATTGGGGG - Intergenic
1082249403 11:49962198-49962220 GACCCCACCTCCAACATTGGGGG - Intergenic
1085007286 11:73104508-73104530 GATCCAGCCTCCCAAAGTGTTGG + Intronic
1086033985 11:82394750-82394772 GGTCCTACCTCCAAAACTGGGGG - Intergenic
1086921170 11:92588838-92588860 AAGCCTCCCTCCAACAGTTTGGG + Intronic
1087858809 11:103127730-103127752 GATCCTACAAGGAACAGTGTTGG - Intronic
1089074206 11:115725103-115725125 GTTCCCACCTCCAACAATGGAGG - Intergenic
1090254520 11:125274005-125274027 GATACTACCTTCACCACTGTTGG - Intronic
1091462625 12:656499-656521 GACCCTACCTCCCAAAGTGCTGG - Intronic
1092002870 12:5045610-5045632 GATCTTGCCCCCAACAGTGATGG - Exonic
1092252814 12:6910332-6910354 GATCCTTCCTCCTAAAGTGCTGG - Intronic
1093509413 12:19908289-19908311 GAACCTATCTTAAACAGTGTAGG - Intergenic
1093716941 12:22393414-22393436 GACTCTACCTCCCAAAGTGTTGG + Intronic
1094225312 12:28039017-28039039 CAGTCTACCTCCAGCAGTGTGGG + Intergenic
1095043019 12:37464977-37464999 GATCCATTCTCCAACAATGTGGG - Intergenic
1097779067 12:63682869-63682891 GATCCTACAGCAAACACTGTGGG - Intergenic
1097805869 12:63964383-63964405 CATCCTTCATGCAACAGTGTTGG + Intronic
1098992064 12:77074481-77074503 CATCCTACCTCCCAAAGTGCTGG + Intergenic
1100523161 12:95395811-95395833 CATCCAACCTCTAACAGTATTGG + Intergenic
1100788071 12:98100035-98100057 GAGCATACATCAAACAGTGTAGG - Intergenic
1104549375 12:129742496-129742518 GATCCCACCTCCCACATTGGAGG + Intronic
1106566803 13:30892447-30892469 AATCCTAACTCCAACAATTTAGG + Intergenic
1110658449 13:78029189-78029211 AAACCTACCTCCAACAGCCTAGG - Intergenic
1110901986 13:80835499-80835521 GGTCCCACCTCCAACACTGGGGG + Intergenic
1112147891 13:96722015-96722037 CATCCAACCTCCCAAAGTGTTGG - Intronic
1112240736 13:97678895-97678917 GACCCTACCTCAAACATTGGGGG - Intergenic
1118807522 14:69250942-69250964 GCTCCTACCTCGAACAATCTCGG + Intergenic
1119196143 14:72718001-72718023 GATCCTACCTCCAAGGGGTTTGG + Intronic
1120392497 14:83925960-83925982 GATTTGACCTCCAAAAGTGTTGG + Intergenic
1123152148 14:106192884-106192906 GGCCCCACCTCCAACATTGTGGG + Intergenic
1123172258 14:106385287-106385309 GGCCCCACCTCCAACATTGTGGG + Intergenic
1202941560 14_KI270725v1_random:152579-152601 GATCCATTCTCCAACAATGTGGG - Intergenic
1123400532 15:19980830-19980852 GGCCCCACCTCCAACATTGTGGG + Intergenic
1124699454 15:31900069-31900091 GGTCCCACCTCCAACACTGGGGG - Intergenic
1125671131 15:41473569-41473591 GATCCTATCTCAAACAGGCTGGG - Intronic
1126291915 15:47090813-47090835 GATCCATTCTCCAACAATGTGGG + Intergenic
1127008483 15:54596644-54596666 GATCCCACCTCCAACACTGGGGG - Intronic
1130827491 15:87564666-87564688 GATTCTGTCTCCAACAGAGTGGG + Intergenic
1131810367 15:96167011-96167033 GATGCAAACTCCAACACTGTGGG - Intergenic
1132487504 16:202373-202395 GACCCCACCTCCAACATTGGAGG + Intronic
1133915088 16:10102179-10102201 GGCCCTACCTCCAACACTGGAGG - Intronic
1134816866 16:17213065-17213087 GGTCCCACCTCCAACACTGTGGG - Intronic
1135809410 16:25574001-25574023 AATCCCACCAGCAACAGTGTGGG - Intergenic
1138814096 16:60184267-60184289 GATCCTAACTTCCACAATGTTGG + Intergenic
1139787551 16:69406192-69406214 GAGCCTACCTCCAGCAGCTTGGG + Intronic
1139979912 16:70848464-70848486 GATCCTCCCTCCCCCAGGGTTGG + Intronic
1141353832 16:83324379-83324401 GATGCTACTTCCAAGAGTGATGG - Intronic
1146552490 17:33793620-33793642 GATCCTACCTCCTACAAGATAGG - Intronic
1147135098 17:38429545-38429567 GATCCCACCTTCAACACTGCCGG - Intronic
1148869455 17:50647692-50647714 GGACCTCCCTGCAACAGTGTGGG - Intronic
1150331838 17:64300724-64300746 GATACTAACACCTACAGTGTGGG + Intergenic
1151039718 17:70844433-70844455 AATCCCACCTCCAACATTGGAGG + Intergenic
1153461795 18:5342806-5342828 GACCCCACCTCCAACATTGAAGG - Intergenic
1153481401 18:5550773-5550795 GTTGCTACCTCAAACAGGGTAGG - Intronic
1162733324 19:12731871-12731893 GATTCTACCTCCCAAAGTGCTGG - Intronic
1166412823 19:42567986-42568008 GATGCCACCAACAACAGTGTAGG - Intergenic
1166845949 19:45728584-45728606 GCTTCAACCTCCAAAAGTGTTGG - Intronic
1167857378 19:52253659-52253681 GATCCAACCTCCCAAAGTGCTGG + Intergenic
925258513 2:2509863-2509885 GGTCCCACCTCCAACACTGGAGG + Intergenic
925552139 2:5087749-5087771 GACCCCACCTCCAACACTGGGGG + Intergenic
925847009 2:8043595-8043617 AATCCTAACTCCAAGAGTGATGG + Intergenic
931196110 2:60053716-60053738 GCCCCTCCCTCCAACACTGTTGG + Intergenic
931774936 2:65532481-65532503 CATCCCAACTCCAAGAGTGTTGG - Intergenic
931956210 2:67428424-67428446 GATCCTCCCTCCCAAAGTGCTGG + Intergenic
932664740 2:73687695-73687717 GGTCCAACCTCCAACACTGGGGG - Intergenic
932820274 2:74893955-74893977 CATACTTCCACCAACAGTGTAGG - Intergenic
933676953 2:85065443-85065465 GATCCTGCCTCCAGCAGTGGTGG - Intergenic
936611246 2:114004222-114004244 GGCCCCACCTCCAACAGTGGGGG - Intergenic
946049214 2:216847853-216847875 GTTCGTACCTACAACACTGTTGG - Intergenic
947203362 2:227637081-227637103 GATCCCACCCCCCAAAGTGTTGG - Intergenic
948209664 2:236183494-236183516 GGCCCCACCTCCAACAGTGGAGG - Intergenic
1168930854 20:1622781-1622803 GGTCCTACCTCCAACACTGGGGG + Intergenic
1173698521 20:45044888-45044910 GATCCTTTCTCCAACTCTGTGGG - Intronic
1176581604 21:8534355-8534377 GATCCATTCTCCAACAATGTGGG + Intergenic
1179604817 21:42507877-42507899 GGTCCCACCTCCAACAGTGGGGG + Intronic
1180264439 22:10511427-10511449 GATCCATTCTCCAACAATGTGGG + Intergenic
1180727516 22:17957467-17957489 GATCCTCCCTCCCAAAGTGCTGG - Intronic
1181487387 22:23240056-23240078 GATCCTGCCTCCCAAAGTGCTGG + Intronic
1182260313 22:29069390-29069412 GACCCAAACTCCAACATTGTAGG + Intergenic
1183105712 22:35613745-35613767 GATCCTGCCTCCCAAAGTGCTGG + Intronic
1183486858 22:38092751-38092773 GATCCCACCTCCAACACTGGGGG - Intronic
952689302 3:36185571-36185593 CTTCCTTCCACCAACAGTGTAGG + Intergenic
953565594 3:44029184-44029206 GACTCTGCCTCCAACAGTGTGGG - Intergenic
954069910 3:48135359-48135381 TCTCATACCTCCAACAGAGTGGG - Intergenic
955202833 3:56866499-56866521 ATTCCTACCTCCAACAATGCTGG + Intronic
957151441 3:76491196-76491218 GATCCGACCTCCCAAAGTGCTGG + Intronic
962009182 3:131377599-131377621 AATCCTAACTCCAATTGTGTTGG + Intergenic
962408798 3:135123251-135123273 GTTCCTACTTCAAAGAGTGTTGG + Intronic
963195585 3:142525583-142525605 GATCTCACCTCCAACACTGGGGG - Intronic
963777458 3:149453423-149453445 GACCTTACCTCCAACACTGGGGG + Intergenic
966425536 3:179776048-179776070 GGTCCCACCTCCAACATTGGGGG + Intronic
967373801 3:188778499-188778521 GATCCTATCTACAGCAGGGTTGG - Intronic
969035594 4:4250893-4250915 AATCCTGCCTCCATCACTGTGGG + Intergenic
970093974 4:12441636-12441658 GATCGTTCCTCCAACATTTTCGG - Intergenic
971031658 4:22643833-22643855 GGCCCCACCTCCAACACTGTGGG + Intergenic
976798042 4:88956901-88956923 GGTCCTACCTCCAACATTTGGGG - Intronic
978381404 4:108132918-108132940 GCCCCTACCTCCCAAAGTGTTGG + Intronic
979224027 4:118264802-118264824 GATCCTATCTCCTTGAGTGTAGG + Intergenic
981355304 4:143783406-143783428 AGTCCTACCTCCAACATTGGAGG - Intergenic
982764722 4:159332616-159332638 GTTCCTTCCTCCCACAGTGTTGG - Exonic
983845532 4:172513795-172513817 ACTCCTACCTCCAACAGAGCAGG - Intronic
984239425 4:177199853-177199875 GGTCCCACCTCCAACATTGAGGG + Intergenic
984244117 4:177254107-177254129 GATCCCACCTCTAAGAGTGGAGG - Intergenic
984429361 4:179628138-179628160 GATGCTACTTCCAGCAGTGCAGG - Intergenic
985379559 4:189378098-189378120 AATCCCACCTTCAACAGCGTTGG - Intergenic
985535007 5:459717-459739 GAGCCTGACTCCAACAGAGTTGG - Intronic
985967586 5:3349258-3349280 GATGTCACCTCCAACAGTGGTGG - Intergenic
986158873 5:5205517-5205539 GGTCCAACCACCAAAAGTGTGGG - Intronic
986595831 5:9420763-9420785 GATTCCACCTCCCAAAGTGTTGG - Intronic
989753022 5:44918761-44918783 GATCCTTCCTCCCAAAGTGCTGG - Intergenic
990269973 5:54126578-54126600 GGTCCTCAATCCAACAGTGTTGG + Intronic
991364386 5:65853273-65853295 GACCCCACCTCCAACATTGGGGG - Intronic
993758104 5:91757193-91757215 GATTCTACCTGCAACCATGTAGG - Intergenic
997841504 5:137244865-137244887 GATCCAACCCCCTACAGGGTGGG + Intronic
1000561262 5:162792134-162792156 GGTCCCACCTCCAACACTGGAGG + Intergenic
1001878363 5:175220432-175220454 GCTCCTAACTCCAAGAGTGAAGG + Intergenic
1003809028 6:9758998-9759020 GATCCTCTCTCCTAGAGTGTGGG + Intronic
1004955667 6:20725170-20725192 GATACTAACTTCTACAGTGTTGG + Intronic
1007219162 6:40264929-40264951 GATCCAAACTCCAGCAGTCTGGG - Intergenic
1008584254 6:52934734-52934756 GACCCCACCTCCAACAATGGAGG - Intergenic
1008871627 6:56279028-56279050 GGCCCTACCTCCAACATTGGGGG - Intronic
1011179634 6:84605675-84605697 GATTCTACTTCCAAAACTGTTGG - Intergenic
1011512015 6:88111916-88111938 CATCATAGCTCCAACAGTGGGGG - Intergenic
1016628856 6:146203846-146203868 GCTCCAACATCCAACATTGTGGG - Intronic
1019002144 6:168763308-168763330 GGCCCCACCTCCAACAGTGGAGG + Intergenic
1020775741 7:12451560-12451582 GACCCCACCTCCAACATTGGAGG - Intergenic
1020897624 7:13960899-13960921 GATCCTTCCTCACAAAGTGTTGG - Intronic
1022873440 7:34503495-34503517 GGCCCTACCTCCAACATTGGGGG + Intergenic
1022937991 7:35200512-35200534 GATCCTACAGCAAACACTGTGGG - Intergenic
1023492958 7:40763795-40763817 GATCCTAACTCCACGAGTGAAGG - Intronic
1023716144 7:43046388-43046410 AATGCTACCTCCGAGAGTGTTGG - Intergenic
1024677531 7:51650530-51650552 GGCCCCACCTTCAACAGTGTGGG - Intergenic
1026010164 7:66629593-66629615 GATCCTCCCTCCCAATGTGTTGG - Intronic
1030082567 7:105790350-105790372 CATCCTACCTCCCAAAGTGCTGG - Intronic
1035079815 7:156206522-156206544 CATCCTTCCTCAAACAGTGTAGG - Intergenic
1036905617 8:12706522-12706544 GATACTACTCCCAACAGCGTAGG + Intergenic
1037211994 8:16400056-16400078 GATCCTACCTCCAACAGTGTGGG - Intronic
1038245898 8:25855819-25855841 GACCCTCCCTCCAAAAGTGAAGG + Intronic
1038365487 8:26927808-26927830 GTGCCTGCCTCCAACAGAGTGGG + Intergenic
1041349174 8:56931306-56931328 GATCCTGCCTCTAACAGTAAGGG - Intergenic
1041606289 8:59786043-59786065 GGTCCCACCTCCAACATTGGGGG - Intergenic
1044708407 8:95031075-95031097 GGCCCCACCTCCAACATTGTGGG + Intronic
1047015299 8:120717795-120717817 GATCCTTCCTTTAACAGTGTGGG - Intronic
1049489332 8:142885873-142885895 GGTCCCACCTCCAACACTGGAGG - Intronic
1050051518 9:1607051-1607073 GATTCTGGCTCCAACAATGTTGG + Intergenic
1050696287 9:8282888-8282910 CCTCCAACCTCCAGCAGTGTAGG + Intergenic
1050849654 9:10267253-10267275 CAACCTACTTCCAAAAGTGTTGG - Intronic
1055951806 9:81736217-81736239 GGTCCCACCTCCAACATTGGGGG + Intergenic
1056515896 9:87349716-87349738 GATCCACCCTCCCAAAGTGTTGG - Intergenic
1057361649 9:94378734-94378756 GACCCCACCTCCAACACTGGGGG + Intronic
1058588525 9:106535797-106535819 TATCCTACCTTCATCTGTGTTGG - Intergenic
1059202559 9:112431540-112431562 GACCCCACCTCCAACACTGGGGG - Intronic
1203611623 Un_KI270749v1:12392-12414 GATCCATTCTCCAACAATGTGGG + Intergenic
1189772306 X:44438589-44438611 GGCCCTACCTCCAACATTGAGGG - Intergenic
1190132061 X:47757054-47757076 GGTCCCACCTCCAACATTGGAGG + Intergenic
1193628124 X:83844818-83844840 GACCCCACCTCCAACATTGTGGG + Intergenic
1196416822 X:115479925-115479947 GACCCCACCTCCAACACTGGGGG - Intergenic
1196784025 X:119406687-119406709 CATCTTACCTACAACAGTGAGGG - Exonic
1198066887 X:133107008-133107030 GGTCCCACCTCTAACATTGTGGG + Intergenic
1200314619 X:155118798-155118820 GGCCCTACCTCCAACATTGGGGG + Intronic