ID: 1037216420

View in Genome Browser
Species Human (GRCh38)
Location 8:16457654-16457676
Sequence ATAAGGATATTTAACCCTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037216418_1037216420 0 Left 1037216418 8:16457631-16457653 CCTTGAAAAGACTTTCTTCAAGA 0: 1
1: 0
2: 5
3: 23
4: 317
Right 1037216420 8:16457654-16457676 ATAAGGATATTTAACCCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037216420 Original CRISPR ATAAGGATATTTAACCCTAA AGG Intronic
No off target data available for this crispr