ID: 1037220495

View in Genome Browser
Species Human (GRCh38)
Location 8:16513482-16513504
Sequence GAATGAATAAAGGCTAGCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037220493_1037220495 14 Left 1037220493 8:16513445-16513467 CCATACATACAGTAGGGACTCAG 0: 1
1: 0
2: 7
3: 60
4: 586
Right 1037220495 8:16513482-16513504 GAATGAATAAAGGCTAGCTATGG No data
1037220490_1037220495 25 Left 1037220490 8:16513434-16513456 CCTAGTCTCTTCCATACATACAG 0: 1
1: 0
2: 1
3: 25
4: 691
Right 1037220495 8:16513482-16513504 GAATGAATAAAGGCTAGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037220495 Original CRISPR GAATGAATAAAGGCTAGCTA TGG Intronic
No off target data available for this crispr