ID: 1037220500

View in Genome Browser
Species Human (GRCh38)
Location 8:16513557-16513579
Sequence TAGAAACATCAATATGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 293}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037220500 Original CRISPR TAGAAACATCAATATGGGCA AGG (reversed) Intronic
900731497 1:4264525-4264547 TAGATACATAAATATATGCATGG + Intergenic
902044567 1:13514789-13514811 TAGAAACTTCTATATGGGGAGGG + Intergenic
902147206 1:14412808-14412830 TAAAAAGAACAATATGGGGAGGG + Intergenic
902273721 1:15324846-15324868 TAGAAACACCACTGGGGGCAAGG - Intronic
903424835 1:23245873-23245895 TGGAAACATCACGCTGGGCACGG + Intergenic
904258393 1:29272186-29272208 TAGAAAAATCTCTATGGGCCAGG + Intronic
905306177 1:37019904-37019926 TAGAAAAATCCAGATGGTCAGGG - Intronic
905976980 1:42182977-42182999 TAAAAACATTATTCTGGGCAAGG + Intronic
906015761 1:42577933-42577955 TTGAAACATCACTATGGGCCAGG - Intronic
906270760 1:44476501-44476523 TAGAAACAGCAGTCAGGGCATGG - Intronic
907593442 1:55697881-55697903 TAGTAACACCACTCTGGGCATGG + Intergenic
909124348 1:71646886-71646908 TAGAAATATTAATATATGCAGGG - Intronic
910373170 1:86540210-86540232 TAGAAAAATGAGTATGGTCAAGG + Intergenic
911080142 1:93920703-93920725 TAGAATTTTCAATGTGGGCAGGG - Intergenic
911080398 1:93923540-93923562 TAGAAAAATTAATATTGGCCGGG + Intergenic
911316756 1:96365189-96365211 TTGAAACATCATTATGGAGAGGG - Intergenic
911617314 1:100028621-100028643 AAGAAAGACCAATATGGGCTGGG - Intergenic
911955668 1:104231586-104231608 TAGAAATATCAATATTAACAAGG - Intergenic
913378452 1:118182829-118182851 TAGGAAGATGAATATGGGCTGGG - Intronic
914049485 1:144119638-144119660 TAGAATCATCAACATTGGCCAGG + Intergenic
914129697 1:144845802-144845824 TAGAATCATCAACATTGGCCAGG - Intergenic
915437040 1:155915273-155915295 TAGAAAAATTAAGCTGGGCATGG - Intronic
916008573 1:160683902-160683924 CAGAAACATGGATATGGGGAGGG - Intronic
916217878 1:162413289-162413311 TTGAAACAGCAAAAAGGGCAAGG - Intergenic
917049823 1:170908438-170908460 TTGAAACCTCAGTATGTGCAAGG - Intergenic
917142608 1:171852189-171852211 AAGAAACCTCAATAGGGGAAAGG - Intronic
917938068 1:179888820-179888842 TAAAAACATTAATGTGGGCCAGG - Intronic
918770297 1:188548932-188548954 TAGAAACAACAAAAAGGGCAGGG - Intergenic
920997242 1:211006087-211006109 TGGAAACATCAGTGTTGGCAAGG + Intronic
924327874 1:242913753-242913775 TTGAAAAATCACTATGGGCCGGG + Intergenic
1063354840 10:5388371-5388393 GAGTAACATAAATAAGGGCAGGG + Intergenic
1064040130 10:11954678-11954700 TAGAAACAAGAATTTGGGCTGGG + Intronic
1064898799 10:20270815-20270837 TAGAAAATTCAATTTCGGCAGGG - Intronic
1065493296 10:26304358-26304380 CAGAAACACCAATTTGGGAACGG - Exonic
1065713455 10:28539852-28539874 TAAAAACTTCACTATGGGCCAGG - Intronic
1065951082 10:30651853-30651875 TAGAGACATCCATGTGGGCCAGG + Intergenic
1066262952 10:33746679-33746701 TAGTGACAACAATATGGTCAAGG - Intergenic
1066408283 10:35141350-35141372 TAGAAACATAACTATTGGCATGG + Intronic
1066704497 10:38163266-38163288 TAGTAACAGCAATAAGTGCATGG + Intergenic
1066986080 10:42467927-42467949 TAGTAACAGCAATAAGTGCATGG - Intergenic
1067495235 10:46755598-46755620 TAGAAATATGAATATAGGCCGGG - Intergenic
1067599419 10:47584790-47584812 TAGAAATATGAATATAGGCCGGG + Intergenic
1067949078 10:50711376-50711398 TAGAAATATGAATATAGGCCGGG + Intergenic
1068062784 10:52090106-52090128 TAGAAACAACAATCTAGGCCGGG - Intronic
1068095387 10:52485099-52485121 TACAATCATCAATATGGATATGG - Intergenic
1069713108 10:70502781-70502803 TGGAAACACCCATGTGGGCATGG - Intronic
1070226213 10:74509484-74509506 TCAAAACATCATTATGGGCCGGG - Intronic
1070235428 10:74620015-74620037 TCAAAACATCACGATGGGCAGGG - Intronic
1070378788 10:75860615-75860637 TAGAAACATCATAATGTGCCAGG - Intronic
1070884392 10:79876382-79876404 TAGAAATATGAATATAGGCCGGG + Intergenic
1070920067 10:80179025-80179047 TAGAAATTACAATTTGGGCAGGG - Intronic
1071284142 10:84128759-84128781 TAGAATCATCAATAAGGAGAGGG - Intergenic
1071650952 10:87392679-87392701 TAGAAATATGAATATAGGCCGGG + Intergenic
1072985628 10:100137313-100137335 AAGAAACACCAAACTGGGCAAGG - Intergenic
1073994489 10:109300211-109300233 GAGAACCATCACTAAGGGCATGG + Intergenic
1074365085 10:112851413-112851435 TAGAAAGATCTTTCTGGGCAGGG - Intergenic
1075752482 10:124784633-124784655 TAAAAACATAAAAATAGGCAGGG + Intronic
1075897072 10:126005596-126005618 TAGAAACATCAGGCTGGGCACGG - Intronic
1078129972 11:8605365-8605387 TAAAAACCTCATTATGGGCCGGG + Intergenic
1079190209 11:18270652-18270674 TAGAAACATCATTGAGGACAAGG - Intergenic
1080421591 11:32115942-32115964 TAGAAACAGCAATATCTGCAGGG + Intergenic
1080790430 11:35517867-35517889 TAAATACATGAATATGGACATGG + Intronic
1085124122 11:73986368-73986390 AACAAACATCAAAATGGACATGG - Intergenic
1085145108 11:74188478-74188500 TTGAAATATCAGTATGGGCTGGG - Intronic
1086070649 11:82795427-82795449 AACAAGCATCAAGATGGGCAAGG - Intergenic
1086579112 11:88376346-88376368 TAGAGACAGCAAGATGGGCATGG + Intergenic
1087663558 11:101015613-101015635 TAGGAAAATTATTATGGGCAAGG + Intergenic
1090644170 11:128754071-128754093 TTGAAAAGCCAATATGGGCAAGG - Intronic
1091631280 12:2162731-2162753 TGGTAACATCACTATGGGCCAGG - Intronic
1091685521 12:2558674-2558696 TAGAAACACCCAGATGGCCACGG - Intronic
1092525699 12:9308685-9308707 TAGAAACACCAATATGGGCCAGG - Intergenic
1092541587 12:9423130-9423152 TAGAAACACCAATATGGGCCAGG + Intergenic
1093542724 12:20306008-20306030 TAGAAACATGAAAAAAGGCAAGG + Intergenic
1093938877 12:25031136-25031158 TTGAAACTTCAAAATGTGCATGG - Intronic
1094511455 12:31099372-31099394 TAGAAACACCAATATGGGCCAGG - Intronic
1095377283 12:41545486-41545508 TAATATCATCAATATGGGCTGGG - Intronic
1095755508 12:45762177-45762199 AAGAAGCATTAATATGGGAAAGG - Intronic
1097604636 12:61738156-61738178 TAGTAATAGCAAAATGGGCAAGG + Intronic
1098369580 12:69742513-69742535 TAGAAACATGTTTATTGGCAAGG + Intronic
1098506305 12:71255450-71255472 TAGAAACATAAATCCTGGCAAGG + Intronic
1098563624 12:71905619-71905641 TAGAAATGTCAAAATGGGCCAGG - Intronic
1098697477 12:73578122-73578144 TAGATACATAAATATAGACAGGG - Intergenic
1099064594 12:77957958-77957980 TAGAAACACTGATATTGGCAGGG - Intronic
1099151099 12:79114718-79114740 TAAACACATCAATATAGGCCTGG - Intronic
1099701182 12:86084218-86084240 TAGAAAAATAATTTTGGGCAAGG + Intronic
1103586545 12:121960511-121960533 AAGAATCATCATTATGGGCCAGG - Intronic
1103844256 12:123890579-123890601 TAGAAACATAAATCTTGGCTGGG - Intronic
1105923706 13:24987517-24987539 TAGAAACATCTAGATAGGAAAGG - Intergenic
1107143799 13:37035309-37035331 TAGAAACATTAATATGAGTTTGG + Intronic
1107158873 13:37201924-37201946 TAGAAATAACAATATATGCAAGG - Intergenic
1107307213 13:39035847-39035869 TAGACACATCAACATTGTCATGG - Intronic
1108394777 13:49981513-49981535 TAGAAAGATCACTCTGGGCTAGG - Intergenic
1108650522 13:52474193-52474215 TAGAAATTTCAGTACGGGCATGG + Intronic
1109880364 13:68465817-68465839 AAGAAACATCATTCTGGACATGG - Intergenic
1110111946 13:71758803-71758825 TTTAAACTTCAACATGGGCATGG - Intronic
1110754394 13:79154450-79154472 TACAAACTTCAATATGGGCCAGG + Intergenic
1110773866 13:79383635-79383657 TAGAAACATCACTGTTGCCACGG + Intronic
1110928783 13:81188728-81188750 TAGAAAATTAAATATGGGAATGG - Intergenic
1111061916 13:83031267-83031289 AGAAAACATCAATATGAGCATGG + Intergenic
1113573787 13:111380480-111380502 TAGAAACCACCATCTGGGCATGG + Intergenic
1115194291 14:30779228-30779250 TAGAAACCTGAAAATGGACAAGG - Intergenic
1116469695 14:45272594-45272616 TAGAAACATCCAGATAGGTATGG - Intergenic
1119312922 14:73665493-73665515 TAAAAACATGACTATGGGCTGGG + Intronic
1119968076 14:78939138-78939160 TAGAAAAATCACTCTGGGCCGGG - Intronic
1120192419 14:81451266-81451288 TAAAAATATCAATATAGGCCAGG - Intergenic
1123419361 15:20118871-20118893 TAGAATCATCAACATTGGCCAGG + Intergenic
1123528583 15:21125413-21125435 TAGAATCATCAACATTGGCCAGG + Intergenic
1124639020 15:31383603-31383625 TAAAAATATCAAGATGGGCCGGG + Intronic
1124833900 15:33176834-33176856 TAGAAGTATTAATATGGTCAGGG + Intronic
1125091847 15:35802146-35802168 TTTAAAAATCAATATGGGCTGGG - Intergenic
1125114338 15:36071792-36071814 TAGAAACCAAAATCTGGGCATGG - Intergenic
1125656974 15:41366013-41366035 TTGAAACATCACTATGGGCCGGG - Intronic
1127841870 15:62838801-62838823 TAGAAACAGCCATTTGGGCCTGG - Intronic
1128144470 15:65325080-65325102 TAGAAACCACAAAATGGGCCAGG - Intergenic
1129126270 15:73443675-73443697 TAAAAACATCAATAAGGGTGGGG - Intronic
1130673441 15:85932447-85932469 TAGCAACTCCAAAATGGGCAGGG + Intergenic
1130859233 15:87871887-87871909 TTAAGACATCAATATGGGCTTGG - Intronic
1132272084 15:100535565-100535587 TAGAAGTATCCATATGTGCACGG + Intronic
1132272091 15:100535626-100535648 TAGAAGTATCCATATGTGCACGG + Intronic
1133487314 16:6232949-6232971 GAGAACTCTCAATATGGGCAGGG + Intronic
1133648200 16:7784412-7784434 TAGAAAGAACAAGCTGGGCATGG + Intergenic
1135616210 16:23913211-23913233 AAGAACCATGAATATGGACAAGG + Intronic
1136357126 16:29752195-29752217 TAAAAACATCTATATCGGCCGGG - Intergenic
1136636212 16:31525012-31525034 TAGATACATCAATAAAGGAAGGG - Intergenic
1138332899 16:56229501-56229523 TAAAAACAACAATGGGGGCAGGG - Intronic
1139602616 16:67995666-67995688 TTGAAACATCACTATGGGTGGGG + Intronic
1144763732 17:17721960-17721982 TAGAGACTTTAGTATGGGCAGGG + Intronic
1145871550 17:28277601-28277623 TAGAAACAACAATATAGGCTAGG + Intergenic
1146327927 17:31903065-31903087 TAGTAAACTCCATATGGGCAGGG + Intergenic
1148076398 17:44938424-44938446 TAAAAACTTCACTATGGCCAGGG - Intronic
1148405910 17:47415553-47415575 TAAAAAGATTAATATGTGCAAGG + Intronic
1149474974 17:56953119-56953141 TACAAACATCAGGCTGGGCACGG + Intronic
1149955259 17:61042590-61042612 TAGAAAGATCATTCTGGGCTGGG + Intronic
1153211785 18:2774699-2774721 TAGAAACATCAGGCTGGACATGG - Intronic
1154164556 18:12004818-12004840 TAGAATCCACAATATAGGCAGGG - Intronic
1155454832 18:26000200-26000222 TAGAAAGAGTAATATGGGCCAGG + Intergenic
1155863182 18:30930418-30930440 TAAAAACAACAATGTGGACATGG + Intergenic
1156654695 18:39271439-39271461 TAGAAACAGCAATAGGAGAAGGG - Intergenic
1157468603 18:47969910-47969932 TACAATCATGAACATGGGCATGG - Intergenic
1157915615 18:51661011-51661033 TAGAAAGATGAATGTGGGCCAGG + Intergenic
1158323557 18:56290218-56290240 TAGAAACATCCTTATGTTCAGGG - Intergenic
1162856910 19:13475754-13475776 GAGAAACATCAATGGAGGCAGGG + Intronic
1162881332 19:13661952-13661974 TAAAAACTTGAAGATGGGCAGGG + Intergenic
1163070143 19:14833181-14833203 TAAAAACTTCAATATCGGCCAGG + Intronic
1163286986 19:16354988-16355010 TTAAAACATAAAAATGGGCAGGG + Intergenic
1164007427 19:21163419-21163441 TAGCAACATCAGCATTGGCAGGG + Intronic
1202688875 1_KI270712v1_random:72206-72228 TAGAATCATCAACATTGGCCAGG + Intergenic
927604500 2:24474324-24474346 TAAAAACATAAATCTGGGCCGGG + Intergenic
929260049 2:39856299-39856321 TATGAACATCAAGATGGACATGG + Intergenic
929303574 2:40333752-40333774 AAAAAATATCAATATGGGCTGGG + Intronic
930760570 2:55030942-55030964 TAGAAACATTAATGTGGGACAGG + Intronic
931380587 2:61749420-61749442 TAGAAACATAAAGATGAGTATGG - Intergenic
932095842 2:68847600-68847622 TAGAAATATGAATATGGAGACGG - Intergenic
932172594 2:69571012-69571034 TAAAAAAATCAAGGTGGGCATGG - Intronic
932312097 2:70751261-70751283 CAGAAACCTAAAGATGGGCAGGG + Intronic
932656619 2:73616200-73616222 TAGAAAAATCCAAATGGGAAAGG - Intergenic
932787009 2:74614475-74614497 TAAAAATATAAATAAGGGCATGG - Intronic
933136323 2:78740324-78740346 TAGAGACCTCAAGATGGGCGGGG + Intergenic
933681966 2:85109936-85109958 TATAAAAATCAACATGGGCCGGG - Intergenic
933957560 2:87383893-87383915 TAGAATCATCAACATTGGCCAGG - Intergenic
934241680 2:90275788-90275810 TAGAATCATCAACATTGGCCAGG - Intergenic
934271493 2:91540897-91540919 TAGAATCATCAACATTGGCCAGG + Intergenic
935453067 2:103233362-103233384 TAGAAACATTAATAAGGCAAAGG + Intergenic
936679464 2:114753612-114753634 TAGAAATATGAAAATGGGCTGGG + Intronic
937101884 2:119277738-119277760 TAGAGACATGATTATGGACAGGG + Intergenic
938403888 2:131016474-131016496 TAGAAACAGGAATCTGGGCATGG - Intronic
939214727 2:139221340-139221362 TAGAAATATTTATAAGGGCATGG + Intergenic
939553588 2:143646063-143646085 TAGAAACAGTAAGATGAGCAGGG + Intronic
941207639 2:162593986-162594008 TAGTAACATCACTTTGTGCAGGG + Intronic
941448271 2:165628426-165628448 TAAAAACATCAGTATTGGCTGGG + Intronic
944180222 2:196883277-196883299 GAGAAGCACCAATGTGGGCAAGG + Intronic
945068159 2:205964616-205964638 TGGAAACAATAATATTGGCATGG + Intergenic
945639041 2:212399236-212399258 TAGAATGAACAATATGGGCCAGG - Intronic
945658119 2:212650690-212650712 TAAAAACATTTATATAGGCAAGG - Intergenic
946197743 2:218046098-218046120 TCAAAACATCACTATGGGCTGGG - Intronic
947487118 2:230561550-230561572 AATAAAAATCAAGATGGGCACGG + Intergenic
947860954 2:233356882-233356904 TAGAAACATCAAAAATGGTATGG + Intronic
1168842628 20:919449-919471 TAGAAAAATCACTCTGGGCTGGG - Intergenic
1168967764 20:1909484-1909506 AAAAAACATCCATGTGGGCAGGG + Intronic
1169651541 20:7873757-7873779 TAAATTCATCATTATGGGCAGGG - Intergenic
1169708144 20:8531101-8531123 TAGAAAAATGAATAGGGTCATGG + Intronic
1169892503 20:10468715-10468737 GAGAGAAATCAATATGGGAAAGG - Intronic
1170535785 20:17339453-17339475 TAAAAAAATCAACATGGGCTGGG - Intronic
1171133040 20:22672953-22672975 TAGAAAAATCAATATATGAACGG + Intergenic
1172151883 20:32796576-32796598 GGGGAACATCAAGATGGGCAAGG - Intronic
1173058418 20:39638212-39638234 TAGAAAATTCACTATGGTCAGGG + Intergenic
1174011010 20:47449646-47449668 TAAAAAAAACAATATGGGCTGGG - Intergenic
1174279044 20:49425116-49425138 TAGAAGCCTCAAATTGGGCAGGG - Intronic
1174331946 20:49827235-49827257 TAAAAAAATAAATATGGGCCGGG - Intronic
1175257437 20:57655771-57655793 TAGAAGCATCTAAATGGGGAAGG - Intronic
1176225264 20:63994451-63994473 TAGAAAAATCAATTTAGGCCGGG - Intronic
1179187869 21:39098473-39098495 GAGAAACATCAAAAGAGGCAGGG + Intergenic
1180552548 22:16552391-16552413 TAGAATCATCAACATTGGCCAGG - Intergenic
1180744161 22:18075705-18075727 TACAAATATTAATATGGGCCTGG + Intergenic
1181351485 22:22261641-22261663 TAGAATCATCAACATTGGCCAGG + Intergenic
1182157727 22:28091523-28091545 TAGAAACATGAAAAAGGGAAAGG + Intronic
1184972350 22:48034408-48034430 CAAAAAAATCAATATTGGCAGGG - Intergenic
949715575 3:6927135-6927157 TAGAAAAATGAAGCTGGGCATGG + Intronic
949863204 3:8524978-8525000 TCAAAACATCAATTTGGGCTAGG - Intronic
950950591 3:16994316-16994338 TAAAAACGTCAATATCTGCATGG - Intronic
953944419 3:47134064-47134086 CAGAAACAGAAATATTGGCAGGG + Intronic
954470515 3:50690427-50690449 TATATACTTCAAAATGGGCAGGG - Intronic
955712758 3:61797474-61797496 TACAAACATCACTATGTGAAAGG + Intronic
956022256 3:64945394-64945416 TATTAACATAAATATGTGCATGG - Intergenic
956104510 3:65803065-65803087 AAGAAACAAAAAAATGGGCAAGG - Intronic
957970220 3:87374325-87374347 AAGATACATTAATATGTGCAAGG + Intergenic
961989194 3:131169203-131169225 CATAAACATGTATATGGGCAAGG - Intronic
963334634 3:143959981-143960003 TATTAACATCTATAGGGGCAAGG - Intergenic
964017084 3:151960987-151961009 TAGAAGCATCATTAAGAGCACGG - Intergenic
965798151 3:172463150-172463172 CAGAAACATAAATAGGGTCAAGG - Intergenic
966109677 3:176384503-176384525 TAGAAATATGATTATGGGCCGGG + Intergenic
966535945 3:181033999-181034021 TAGAAAAATCAAAATTGGCCAGG + Intergenic
969188885 4:5501075-5501097 TAGAAACACAAAAATGGGCATGG + Intergenic
970502483 4:16692391-16692413 TAGATACATCCCTAAGGGCAAGG - Intronic
971381172 4:26099420-26099442 CAGGAACATCAATTTGGGAAAGG - Intergenic
972161509 4:36233627-36233649 TAGAGACATTGACATGGGCACGG - Intronic
972598524 4:40551169-40551191 TACACACATCACTATGGGCTTGG + Intronic
973556175 4:52085565-52085587 TAAAAACATTATTATGGGCTGGG + Intronic
974791083 4:66690972-66690994 GAGAAACATCAATATAGTCATGG + Intergenic
975793024 4:77975393-77975415 TAGAAAAATCAATATTGTTAAGG - Intergenic
976161921 4:82210847-82210869 TAGAAAAATTTAGATGGGCATGG + Intergenic
976204108 4:82608398-82608420 TTTAAACATCAACATGGGCCAGG - Intergenic
976954340 4:90876828-90876850 TAGATACATCAATAAAGGAAGGG - Intronic
977811087 4:101356840-101356862 TAGAAACAATGGTATGGGCAAGG - Intergenic
980346617 4:131630465-131630487 TAGACACATTACTGTGGGCAGGG + Intergenic
981504457 4:145483416-145483438 TTGAAAAATCAACATGGGCAGGG - Intronic
981888651 4:149710502-149710524 GAGCAACAAGAATATGGGCATGG - Intergenic
983203553 4:164887900-164887922 TAGAAAGATCAGACTGGGCACGG - Intronic
983367985 4:166819873-166819895 TATAAATATTAATCTGGGCATGG - Intronic
985177110 4:187213923-187213945 TAGAAACAAAAATATTGGCGGGG - Intergenic
985622720 5:963879-963901 GAGAAACACCAACATGGACAGGG + Intergenic
987084231 5:14454222-14454244 ATGAAAGATCAATCTGGGCAGGG - Intronic
987808902 5:22807341-22807363 TATAAACAGTAATATGTGCAAGG - Intronic
988331363 5:29844777-29844799 TAGAAATAGAAATATGGGCCGGG + Intergenic
989036052 5:37173030-37173052 GAGAATCATCAATATGGAAATGG + Intronic
989329337 5:40237752-40237774 TAGAAAAATAACTAAGGGCATGG + Intergenic
990884951 5:60580653-60580675 TAGAAACATCAGGAAAGGCATGG - Intergenic
991036969 5:62137057-62137079 TGCAAACATCAATAGGGGTAAGG + Intergenic
991285979 5:64976376-64976398 TAAAAATATCAATATAGGGAAGG - Intronic
991501034 5:67277996-67278018 TAGAAAGATCAACTTGGGGAAGG - Intergenic
991688455 5:69203951-69203973 TATAAACATTTATATGGACATGG + Intronic
993044333 5:82850188-82850210 TAAAAACATCAAAATGTGCTAGG + Intergenic
995127339 5:108591394-108591416 TGGAAACAACAATATGAGAAAGG - Intergenic
995545640 5:113227657-113227679 TAGAACAAACAATATGGGGATGG + Intronic
996704992 5:126488763-126488785 GAGAAAAATTATTATGGGCAGGG - Intronic
999608216 5:153339654-153339676 TAGAAGCATTAATATGAGAATGG - Intergenic
1000530681 5:162415955-162415977 TTGTTGCATCAATATGGGCATGG - Intergenic
1001896541 5:175387138-175387160 TAGAAAGAGCTATATGTGCAAGG + Intergenic
1003400594 6:5787296-5787318 TAGAAACATCTAGATAGGAAAGG - Intergenic
1006320964 6:33319227-33319249 CAGAAACATAAATATGTGGAGGG + Intronic
1007834579 6:44664798-44664820 TAGAAACATAAATTAAGGCAGGG - Intergenic
1009452116 6:63813273-63813295 TAAAAACAACAATTTGGGCCAGG - Intronic
1011425564 6:87225446-87225468 TAGAAAAATCTATATGGCCTTGG - Intronic
1013199352 6:107877735-107877757 TAAAAACATAAATATGGGCCAGG - Intronic
1013267002 6:108509571-108509593 TAGAAATAAAAATATGGACAGGG + Intronic
1015516687 6:134089445-134089467 TAAAAACATGAATTTGGGCCAGG + Intergenic
1016785341 6:148005431-148005453 TAGAAAAAACAAAAAGGGCAAGG - Intergenic
1017029342 6:150207156-150207178 TAAAAACATCAAAATAGGCCGGG - Intronic
1018251881 6:161879639-161879661 TAGAAATATCATAATGGGCTGGG - Intronic
1018288534 6:162266113-162266135 TAGAAACCTCAAGATAGGCTAGG - Intronic
1018358957 6:163045907-163045929 TAGAATCATCAGTTTGGGCCGGG - Intronic
1019705514 7:2495546-2495568 TCAAACCATAAATATGGGCAGGG + Intergenic
1020510186 7:9046950-9046972 TAAAAACAAAAATTTGGGCATGG + Intergenic
1021843877 7:24745407-24745429 GAGAATCATAAATATGGGAAGGG - Intronic
1024470166 7:49761097-49761119 TAATAACATCAATATTGGCAAGG + Intergenic
1027649777 7:80852274-80852296 TAGTAACATGAATAAGGTCAGGG - Intronic
1028158009 7:87453862-87453884 TGGAAAAATCAATATGGAAAGGG - Intronic
1028286309 7:89006621-89006643 TAAAAACTTTAATATGGCCATGG - Intronic
1028531718 7:91845673-91845695 TAGGATCCTGAATATGGGCAAGG + Intronic
1028635568 7:92985329-92985351 AAGAAATAACAATATGGGCCGGG - Intergenic
1029007746 7:97228389-97228411 TAGGAACATCAACATTGTCAGGG - Intergenic
1031055340 7:116987234-116987256 TAGAGCCATCAAAATGGGCTGGG + Intronic
1031473289 7:122192259-122192281 TTGAATCATCAAGGTGGGCAGGG + Intergenic
1032189266 7:129754164-129754186 TAAAAAAATCAAAATGGTCAGGG + Intronic
1033961847 7:146923346-146923368 AAGAAACATCAAGATGCACAAGG + Intronic
1034648576 7:152670884-152670906 TAAAAACATCTGTATGGGCTGGG - Intronic
1034651272 7:152692482-152692504 TAGAACAATCAATATGGTAATGG + Intergenic
1036465315 8:8992043-8992065 AAGAAACACCATTCTGGGCATGG + Intergenic
1037220500 8:16513557-16513579 TAGAAACATCAATATGGGCAAGG - Intronic
1039117365 8:34106720-34106742 TAGAAATATCAATGTGAGGAAGG + Intergenic
1039642180 8:39235790-39235812 TAGACACATCATCATGGTCAAGG + Intronic
1041192548 8:55368248-55368270 TAGAAAGATCATTGTGGGCCAGG - Intronic
1044752974 8:95433904-95433926 AAGAAACTTCATTATGGGGAAGG - Intergenic
1044955967 8:97480984-97481006 TAGAAACACCATTCTGGACATGG + Intergenic
1049061601 8:140280302-140280324 TAGAAAGATGAATTTTGGCAAGG - Intronic
1049107597 8:140623557-140623579 TAGCAACATCCAGAAGGGCAGGG + Intronic
1051543615 9:18249450-18249472 TAGAGACATCAATATAGAGAGGG + Intergenic
1051737194 9:20212617-20212639 TAGAAAGATCAATAACGCCAGGG + Intergenic
1051865560 9:21677079-21677101 TGAAAACATCCAAATGGGCAAGG + Intergenic
1052064520 9:24000392-24000414 TTAAAACACCAATATGGGCTGGG - Intergenic
1053322612 9:37113715-37113737 TAAAAACATAAAAATGGGCTGGG + Intergenic
1055032452 9:71784251-71784273 AAGAAATTTCAATATGGACAAGG + Intronic
1056574049 9:87841727-87841749 TAGAAATATGAATATAGGCTGGG - Intergenic
1057953714 9:99390583-99390605 TAAAAACATCAAGAAGGGCTGGG + Intergenic
1058437488 9:104976457-104976479 TATAAACAACATTATGGGCAGGG - Intergenic
1185532730 X:834713-834735 TAGAATCATCAACATTGGCCAGG - Intergenic
1186304690 X:8243143-8243165 AAGAAACAACAATAGTGGCATGG - Intergenic
1186601279 X:11040441-11040463 TAGCAACTTCACTATGAGCAGGG - Intergenic
1187052169 X:15705771-15705793 TAAAAATAACAATATGGGTAAGG - Intronic
1187763728 X:22615967-22615989 TAGAAGCATACATATGGGAAAGG + Intergenic
1188394897 X:29669925-29669947 TTGAAAGATCAGTATGAGCATGG - Intronic
1188633246 X:32395068-32395090 TAGAAACATCAACATGCCCAAGG + Intronic
1188782080 X:34297658-34297680 TAAAAACATGTATAGGGGCATGG - Intergenic
1188990680 X:36816050-36816072 TAGAGACCTCAATATGAGCTTGG + Intergenic
1189113393 X:38317754-38317776 TAGAAACATCAGAATGGGAAAGG - Intronic
1189251872 X:39606696-39606718 GGGGAACATAAATATGGGCAGGG - Intergenic
1191792184 X:64982630-64982652 TAGAAATCTCAAAATGGACAGGG + Intronic
1193901644 X:87186335-87186357 TAGAAAGCTCAAAATGTGCAGGG + Intergenic
1194973318 X:100368114-100368136 TAGAAAAATCAATATCCGAAGGG + Intronic
1195543917 X:106093681-106093703 ATGAAACAAGAATATGGGCAAGG + Intergenic
1197325872 X:125092570-125092592 TAGAAAAAACAATTTGGGGATGG + Intergenic
1197886976 X:131228821-131228843 AAGAAACATATATATGGGAAAGG - Intergenic
1198488269 X:137110257-137110279 GCAAAACATCAATATGGGTAAGG - Intergenic
1199903524 X:152201500-152201522 GAGACACAGCAATAGGGGCAAGG - Intronic
1200746189 Y:6905887-6905909 TATAAACATGAATATAGGCCGGG - Intergenic
1201069467 Y:10131854-10131876 TAGAAAAATAACTAAGGGCATGG + Intergenic
1201225285 Y:11812714-11812736 TTGAAAAATCACTATGGGCAGGG + Intergenic