ID: 1037221934

View in Genome Browser
Species Human (GRCh38)
Location 8:16534186-16534208
Sequence ATATTTACACAGATGAATCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 152}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037221934_1037221940 25 Left 1037221934 8:16534186-16534208 CCCCGATTCATCTGTGTAAATAT 0: 1
1: 0
2: 1
3: 11
4: 152
Right 1037221940 8:16534234-16534256 AATATGAATACAAATAACCCAGG No data
1037221934_1037221941 28 Left 1037221934 8:16534186-16534208 CCCCGATTCATCTGTGTAAATAT 0: 1
1: 0
2: 1
3: 11
4: 152
Right 1037221941 8:16534237-16534259 ATGAATACAAATAACCCAGGTGG No data
1037221934_1037221937 0 Left 1037221934 8:16534186-16534208 CCCCGATTCATCTGTGTAAATAT 0: 1
1: 0
2: 1
3: 11
4: 152
Right 1037221937 8:16534209-16534231 GAATCTATATTCCCATTGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037221934 Original CRISPR ATATTTACACAGATGAATCG GGG (reversed) Intronic
909832283 1:80207494-80207516 AAATTTACACAAATCAATGGAGG - Intergenic
910011581 1:82470290-82470312 ATATGTGCACAGATGAATGATGG + Intergenic
910545206 1:88408106-88408128 ATTTTTACACAGATGAAGGAGGG + Intergenic
916647779 1:166803856-166803878 ATATTTAAACAGATTAAATGTGG - Intergenic
919322480 1:196060613-196060635 ATTTTTACTCAGATGTATTGTGG - Intergenic
920273251 1:204783181-204783203 ATCTTTGCACAGATAAATTGTGG + Intergenic
923642093 1:235773688-235773710 AGATTTACAGAGATGGATGGTGG + Intronic
924181492 1:241443084-241443106 ATATTTAGACAGATAAATGTTGG - Intergenic
924956553 1:248933799-248933821 ATATTTCGACAGATGCATTGTGG + Intergenic
1062794122 10:330039-330061 ATATTTAAACAAATGAGTGGTGG - Intronic
1065914312 10:30340076-30340098 AGAGTTACGGAGATGAATCGTGG - Intronic
1065936334 10:30523582-30523604 ATATTTACACAGATGGTTTGGGG - Intergenic
1066050307 10:31628529-31628551 ACCTTTACATAGATGGATCGTGG - Intergenic
1066423123 10:35280055-35280077 ATAGATACAAAGATGAAACGTGG - Intronic
1068276354 10:54803567-54803589 ATCTTTAGACAAATGAATAGTGG - Intronic
1068876645 10:62003764-62003786 CTATTTTCAGAGATGAATCCAGG - Intronic
1069040648 10:63692296-63692318 ATGTTCACACATATGAATTGAGG - Intergenic
1070853261 10:79584591-79584613 ATATTTCCACACAGGAATTGGGG - Intergenic
1070869807 10:79741318-79741340 TTATTTACATAGATGTATCCTGG + Intergenic
1071636732 10:87263538-87263560 TTATTTACATAGATGTATCTTGG + Intergenic
1071658517 10:87474416-87474438 TTATTTACATAGATGTATCTTGG - Intergenic
1086452860 11:86934310-86934332 ATATTTACCCAGATGATCCCAGG - Intronic
1086511118 11:87559178-87559200 ATATTTAAATAAATGAATGGTGG + Intergenic
1088141646 11:106624043-106624065 ATATTTACACATATTTATTGTGG - Intergenic
1089771336 11:120805442-120805464 ATATTGAGCCAGATGAATCAGGG + Intronic
1092943441 12:13431577-13431599 ATATTTACACAGATATATGAAGG - Intergenic
1095882930 12:47157730-47157752 ATAGTTACAGAGATGGATCCTGG - Intronic
1099537958 12:83868534-83868556 ATATTTTCAAAGATGAATCTGGG + Intergenic
1100739195 12:97572410-97572432 CTATTTACAGAGATGAGTCATGG - Intergenic
1108283897 13:48886841-48886863 ATATTTAGATATATGAAACGTGG - Intergenic
1108405305 13:50095060-50095082 CTAGTTACAAAGATGAATGGTGG - Intronic
1109133300 13:58614948-58614970 AGATGTACACAGTTGAATAGTGG + Intergenic
1109471323 13:62808703-62808725 ATATTTACAGAAATAAATCAAGG + Intergenic
1109637166 13:65136477-65136499 ATATTTACATATATGAAATGAGG - Intergenic
1110015569 13:70396914-70396936 TTATTTACAGAGAAGAATCCAGG - Intergenic
1112779191 13:102879479-102879501 ATGTATACACAGATGAATCGAGG - Intergenic
1113821532 13:113217504-113217526 ATATTTACAAAGATCAAAAGAGG - Intronic
1114242934 14:20885781-20885803 ATATTTTCACAGAAGAATAAAGG + Intergenic
1114245326 14:20907807-20907829 ATATTTTCACAGAAGAATAAAGG + Intergenic
1114249861 14:20949718-20949740 ATATTTTCACAGAAGAATAAAGG + Intergenic
1126473426 15:49041270-49041292 ATTTTTACAAAGATGATTCTGGG - Intronic
1128652994 15:69433625-69433647 ATTTTTACACAGATGGGTTGAGG - Intronic
1132359931 15:101203634-101203656 ATTTTTACAGAGGAGAATCGTGG + Intronic
1135110253 16:19685334-19685356 ATACCAACACAGATGAATCTTGG - Intronic
1137534615 16:49309611-49309633 ATATTTGCACAGATGCACTGGGG - Intergenic
1137681558 16:50350926-50350948 ATATTTCCACAGATGAGTATTGG + Intronic
1138156206 16:54705764-54705786 ATAATTTCACAGATGAATATAGG + Intergenic
1139235364 16:65332757-65332779 ATATTTACATAGATTACTCTGGG - Intergenic
1141044337 16:80703028-80703050 ATATATACACACATGAATCTAGG + Intronic
1141966069 16:87444504-87444526 ATTTTTACACAGGAGAATCCTGG + Intronic
1148281251 17:46349209-46349231 ATAGTTACAGAAATGAATGGTGG + Intronic
1148303479 17:46567144-46567166 ATAGTTACAGAAATGAATGGTGG + Intronic
1148716256 17:49718346-49718368 ATATTGACACAGTTTAATTGGGG - Intronic
1153596023 18:6725996-6726018 ATTTTTACACAGAACAATGGAGG - Intergenic
1155912356 18:31518583-31518605 ATATATACACAGATGCATAAAGG - Intronic
1159879352 18:73843970-73843992 GTTTTTGCACAGATGAATCACGG + Intergenic
1165219999 19:34307966-34307988 ATCTTTACACAGTTGCATCTTGG + Intronic
925748059 2:7061234-7061256 ATATTTACACAAATGAGTTTGGG - Intronic
925985210 2:9209528-9209550 ATGTTTAAACAAATGAATCACGG + Intronic
926205545 2:10832622-10832644 ATATTTACACTAAAAAATCGGGG + Intronic
930603045 2:53464147-53464169 ATATTTCCATGTATGAATCGTGG - Intergenic
931704300 2:64934450-64934472 ATTTTTACACAGAAGAATCTAGG - Intergenic
940487207 2:154311233-154311255 ATAATTGCACAGATATATCGGGG + Intronic
940619355 2:156091588-156091610 ATGATTACAAAGATGAATCATGG - Intergenic
941883983 2:170509607-170509629 TTATATACACAAATGAATCAAGG - Intronic
941947967 2:171121125-171121147 AAATTTCTACAGATGAATAGTGG + Intronic
942779573 2:179625518-179625540 ATATATAAACAGATGAATAAAGG + Intronic
942871753 2:180742701-180742723 ATATTTAAACAGAGGCATGGAGG - Intergenic
943389053 2:187239611-187239633 ATTTTTCCACAAATGAATCCTGG + Intergenic
945321255 2:208425984-208426006 ATATTTACTGAGAGGAATTGGGG + Intronic
945689172 2:213010878-213010900 ATATTTAGGCATATGAATGGGGG + Intronic
946988932 2:225305631-225305653 ATATTTGCACAGAGCAATAGTGG + Intergenic
948546646 2:238736321-238736343 AAATTAACACAGATAAATCAGGG - Intergenic
1169011880 20:2257872-2257894 ATAATTACACAGAGGAAATGAGG - Intergenic
1169556183 20:6752731-6752753 ATATTTAAACAGGAGAATCAAGG - Intergenic
1178458996 21:32784060-32784082 ATATTAACAGTGATGAATCTAGG - Intergenic
1183500882 22:38178218-38178240 ATATTTACTGAGATGGATTGTGG + Intronic
1183823017 22:40362325-40362347 TTATTTCCAGAGATAAATCGTGG - Intronic
949297696 3:2545471-2545493 ATATTTACACACAATAATAGTGG - Intronic
949632818 3:5947342-5947364 ATATTTACATAGATGGATAAAGG - Intergenic
956030413 3:65031057-65031079 ATATATACTCAGATGACTCATGG - Intergenic
956790586 3:72677120-72677142 ATATTAACACTAATGAATCTGGG - Intergenic
956993079 3:74791452-74791474 ATATTTCAACATATGAATCTGGG + Intergenic
957849925 3:85794478-85794500 ATATTTACACAAATGATAAGAGG + Intronic
960125800 3:113997161-113997183 ATAAGTAAACAGATGAATTGTGG + Intronic
960851858 3:122063916-122063938 ATATTTGCACAGAAAAATCTTGG + Intronic
964994406 3:162857343-162857365 ATATGTACACTGATGAATGTGGG - Intergenic
965239422 3:166175961-166175983 ATATTTCCACAGGTGAAACAAGG + Intergenic
966221368 3:177554809-177554831 ATAATTTCACAGAAGAATGGGGG - Intergenic
967315228 3:188146094-188146116 ATATATACACAGTTTAATTGAGG - Intergenic
971779314 4:31010966-31010988 ATATTTCAACAGATTTATCGGGG - Intronic
972168881 4:36320930-36320952 ATATTTACATATATGTATCTAGG + Intronic
972339940 4:38143393-38143415 ATATTTGAACACATGAATGGAGG - Intergenic
974573052 4:63680395-63680417 ATATTTTCACAGACAAATGGGGG - Intergenic
975338721 4:73212026-73212048 ATATTAACTCAGATCAATCCAGG - Intronic
976295832 4:83471047-83471069 ATATTTGCACATTTGAATTGAGG + Intronic
976417901 4:84800683-84800705 ATTTTTTCACAGATGGATTGTGG + Intronic
977688867 4:99880259-99880281 ATATTTACACTGAAGAAGGGAGG + Exonic
979911174 4:126367525-126367547 ATATTTTCCCAGAGGAATCTGGG - Intergenic
982991376 4:162280337-162280359 TTATTTATACAGATTAATCAGGG + Intergenic
984345346 4:178515566-178515588 ATATGTACACACATGAACTGTGG + Intergenic
984460478 4:180030168-180030190 ATACTTGCACAGATGATTTGTGG - Intergenic
986124518 5:4872951-4872973 ATATTTACACAGAAGCACCAGGG - Intergenic
986911217 5:12559733-12559755 AGAATGACACAGATGAAACGTGG + Intergenic
990637843 5:57749474-57749496 ATATTTAAAGAGAAGAATCCTGG + Intergenic
991038646 5:62153675-62153697 ATGTTTACAAAGATAAATCCAGG - Intergenic
992589783 5:78282450-78282472 ATAATCACACAGAAGAATCAGGG + Intronic
993661454 5:90641693-90641715 ATATTTCTACATATGAATTGTGG + Intronic
994061269 5:95480073-95480095 ATATTCACAAAGATTAATCCAGG + Intronic
994556122 5:101306355-101306377 ATATTTACAGAGGTGAATCCAGG - Intergenic
994994103 5:107037489-107037511 ATATTTATACATATGTATGGGGG - Intergenic
995764458 5:115600969-115600991 ATGTTTACACTGTTGAATCATGG - Intronic
996030158 5:118695817-118695839 AAATTTACACAGATTTATTGAGG - Intergenic
996758474 5:126961542-126961564 GTAGTTACACAAATGAATAGGGG - Intronic
997756478 5:136404441-136404463 AAAGTTACACAGAAGAATCAAGG + Intergenic
997847295 5:137298743-137298765 ATATTAACACAGATAAAGAGAGG - Intronic
999081292 5:148846207-148846229 ATATCCACACAGATGAACTGAGG + Intergenic
1002016700 5:176329820-176329842 AGATTTACACATATGAAAAGGGG + Intronic
1007460242 6:42012847-42012869 ATCCTGACACAGATGAATCCAGG + Intronic
1009691960 6:67046868-67046890 ATATGTATATAGAGGAATCGAGG - Intergenic
1011072357 6:83399642-83399664 ATATTTACAAAGATAACTCTGGG - Intronic
1012013162 6:93818711-93818733 ATATTTACACACATGAATGATGG - Intergenic
1012797925 6:103787025-103787047 ATATTTATATAGATGAAACCTGG + Intergenic
1016108710 6:140194323-140194345 AGATTTACGCAGACAAATCGTGG - Intergenic
1018130334 6:160724596-160724618 ATGTTTACACAGAAGAATAGTGG + Intronic
1018412125 6:163560571-163560593 ATATGCACAGAGATGAATGGTGG + Intronic
1018492443 6:164307773-164307795 ATATTTATACAGATGCCTCAGGG - Intergenic
1020157614 7:5739507-5739529 CTATGTAGACAGATGAATCTGGG - Intronic
1021041570 7:15869313-15869335 ATGTTTCCACAGGTGAACCGTGG + Intergenic
1024434708 7:49337734-49337756 ATATTTACAGAGAGCAATCTAGG + Intergenic
1027862058 7:83596793-83596815 AGATTTACACAGATAAATATAGG - Intronic
1028789637 7:94839093-94839115 AGAGTTACAGAGATGAATGGTGG - Intergenic
1029841993 7:103374908-103374930 ATATTTACATAGAGAAATCCTGG - Intronic
1030443586 7:109620759-109620781 ATATTTACCCATATGAAACAGGG + Intergenic
1031603033 7:123736339-123736361 AGATTTAGACAGATGAATTAAGG + Intronic
1032713504 7:134483900-134483922 ATATTTACACATATTTATTGAGG - Intergenic
1034982154 7:155486082-155486104 GTATTTATACATATGTATCGCGG - Intronic
1035915875 8:3621501-3621523 AAATTTACAGAGATGAATAGTGG + Intronic
1036028147 8:4933849-4933871 ATATTTACAAAGATACATTGAGG + Intronic
1036385610 8:8277440-8277462 ATATTTACATAGATGAAAGTAGG - Intergenic
1036836248 8:12071061-12071083 ATATTTAAACTTCTGAATCGTGG + Intronic
1036858090 8:12317630-12317652 ATATTTAAACTTCTGAATCGTGG + Intergenic
1037221934 8:16534186-16534208 ATATTTACACAGATGAATCGGGG - Intronic
1037701606 8:21280354-21280376 ATATTTACAAACATGAAACTAGG - Intergenic
1038423489 8:27449737-27449759 ATATTTATACAAATGAACCGTGG + Intronic
1038923027 8:32106839-32106861 ATATTTACAGAGATGAATAAAGG - Intronic
1041156518 8:54992627-54992649 ATATTTTAACATATGAATGGCGG + Intergenic
1042215576 8:66427723-66427745 TTATTTTCACAGATGAAACAAGG - Intergenic
1043084183 8:75807336-75807358 ATATTTAGACATATGATTCTTGG - Intergenic
1044898588 8:96919969-96919991 ATTTTAACATAGATGAATTGAGG - Intronic
1046290156 8:112148717-112148739 ATATTTAAACAGAGGAAACTGGG - Intergenic
1046733608 8:117752188-117752210 ACATTTACACAGCTGCATAGTGG + Intergenic
1050622562 9:7469744-7469766 AGATCTACTCACATGAATCGTGG + Intergenic
1056975163 9:91246077-91246099 ATATTTACAAAGCTGAATCATGG + Intronic
1058066806 9:100557572-100557594 AGATTTAGACAGAGGAATGGTGG - Intronic
1059814545 9:117897540-117897562 ATATTTACACAGCAGAAAAGTGG - Intergenic
1187642418 X:21309081-21309103 AACTTTACATAGATGAATTGTGG + Intergenic
1187979185 X:24736748-24736770 AGAGTTACAGAGATGGATCGTGG - Intronic
1188777220 X:34234733-34234755 ATATTTAAACAGATCATTCCTGG - Intergenic
1193235228 X:79098541-79098563 ATATTTACACACTTAAATGGTGG + Intergenic
1196185255 X:112738625-112738647 AAGTGTACACAGATGAATAGTGG - Intergenic
1197078638 X:122384587-122384609 ATATTTAAACATATGAACCACGG + Intergenic
1200021177 X:153210766-153210788 ATTCTTATCCAGATGAATCGGGG + Intergenic
1200245203 X:154519968-154519990 ATATTTACACAAATAAATAAAGG + Intergenic
1201896233 Y:18995398-18995420 ATATGTACTCAGATGATTCCAGG + Intergenic