ID: 1037223019

View in Genome Browser
Species Human (GRCh38)
Location 8:16548485-16548507
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037223016_1037223019 -9 Left 1037223016 8:16548471-16548493 CCGGTGAGACAAAGGGATTTAAA 0: 1
1: 0
2: 2
3: 26
4: 267
Right 1037223019 8:16548485-16548507 GGATTTAAACTGGAGGAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr