ID: 1037223319

View in Genome Browser
Species Human (GRCh38)
Location 8:16552943-16552965
Sequence CGGGGTAACCTGGACATTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037223314_1037223319 -3 Left 1037223314 8:16552923-16552945 CCAATATTTCTTTGATGTAACGG 0: 1
1: 0
2: 0
3: 2
4: 98
Right 1037223319 8:16552943-16552965 CGGGGTAACCTGGACATTCTAGG No data
1037223313_1037223319 28 Left 1037223313 8:16552892-16552914 CCATCTGGGATTCTCAAATGCTA 0: 1
1: 0
2: 0
3: 24
4: 182
Right 1037223319 8:16552943-16552965 CGGGGTAACCTGGACATTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037223319 Original CRISPR CGGGGTAACCTGGACATTCT AGG Intronic
No off target data available for this crispr