ID: 1037226749

View in Genome Browser
Species Human (GRCh38)
Location 8:16602041-16602063
Sequence TGCCCACTAGGGTCTCTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037226749_1037226755 7 Left 1037226749 8:16602041-16602063 CCACCCAGAGACCCTAGTGGGCA No data
Right 1037226755 8:16602071-16602093 ACAAACAGCTGGACATTGAGAGG No data
1037226749_1037226754 -4 Left 1037226749 8:16602041-16602063 CCACCCAGAGACCCTAGTGGGCA No data
Right 1037226754 8:16602060-16602082 GGCACACACACACAAACAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037226749 Original CRISPR TGCCCACTAGGGTCTCTGGG TGG (reversed) Intergenic
No off target data available for this crispr