ID: 1037229569

View in Genome Browser
Species Human (GRCh38)
Location 8:16640060-16640082
Sequence CTGTGGTAGGCTGGGTGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037229569_1037229574 -2 Left 1037229569 8:16640060-16640082 CCACATCACCCAGCCTACCACAG No data
Right 1037229574 8:16640081-16640103 AGTCTTAGCGTCCACTGTTTTGG No data
1037229569_1037229575 8 Left 1037229569 8:16640060-16640082 CCACATCACCCAGCCTACCACAG No data
Right 1037229575 8:16640091-16640113 TCCACTGTTTTGGAATGAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037229569 Original CRISPR CTGTGGTAGGCTGGGTGATG TGG (reversed) Intergenic
No off target data available for this crispr