ID: 1037229666

View in Genome Browser
Species Human (GRCh38)
Location 8:16642114-16642136
Sequence TATATAAGCATATCAACAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037229666_1037229667 5 Left 1037229666 8:16642114-16642136 CCATCTGTTGATATGCTTATATA No data
Right 1037229667 8:16642142-16642164 CTCCATTTTCTGTTGAAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037229666 Original CRISPR TATATAAGCATATCAACAGA TGG (reversed) Intergenic
No off target data available for this crispr