ID: 1037229667

View in Genome Browser
Species Human (GRCh38)
Location 8:16642142-16642164
Sequence CTCCATTTTCTGTTGAAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037229666_1037229667 5 Left 1037229666 8:16642114-16642136 CCATCTGTTGATATGCTTATATA No data
Right 1037229667 8:16642142-16642164 CTCCATTTTCTGTTGAAATTTGG No data
1037229665_1037229667 21 Left 1037229665 8:16642098-16642120 CCAAATATATTTTTCTCCATCTG No data
Right 1037229667 8:16642142-16642164 CTCCATTTTCTGTTGAAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037229667 Original CRISPR CTCCATTTTCTGTTGAAATT TGG Intergenic
No off target data available for this crispr