ID: 1037243051

View in Genome Browser
Species Human (GRCh38)
Location 8:16799475-16799497
Sequence TAATACCTTCTGCATGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037243043_1037243051 30 Left 1037243043 8:16799422-16799444 CCACTCTACTTGAGCTCCAAGTC No data
Right 1037243051 8:16799475-16799497 TAATACCTTCTGCATGTGCAGGG No data
1037243049_1037243051 -9 Left 1037243049 8:16799461-16799483 CCTCTCTTGGGGTGTAATACCTT No data
Right 1037243051 8:16799475-16799497 TAATACCTTCTGCATGTGCAGGG No data
1037243045_1037243051 14 Left 1037243045 8:16799438-16799460 CCAAGTCTCATAATTTCAGGATT No data
Right 1037243051 8:16799475-16799497 TAATACCTTCTGCATGTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037243051 Original CRISPR TAATACCTTCTGCATGTGCA GGG Intergenic
No off target data available for this crispr