ID: 1037251283

View in Genome Browser
Species Human (GRCh38)
Location 8:16897498-16897520
Sequence CTTTAACCCCAGATGAAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037251283_1037251287 -6 Left 1037251283 8:16897498-16897520 CCATGTTTCATCTGGGGTTAAAG No data
Right 1037251287 8:16897515-16897537 TTAAAGAGGTTAGGTAAATTGGG No data
1037251283_1037251289 24 Left 1037251283 8:16897498-16897520 CCATGTTTCATCTGGGGTTAAAG No data
Right 1037251289 8:16897545-16897567 ACACAGTTTGTTGAAGAGCTGGG No data
1037251283_1037251286 -7 Left 1037251283 8:16897498-16897520 CCATGTTTCATCTGGGGTTAAAG No data
Right 1037251286 8:16897514-16897536 GTTAAAGAGGTTAGGTAAATTGG No data
1037251283_1037251290 25 Left 1037251283 8:16897498-16897520 CCATGTTTCATCTGGGGTTAAAG No data
Right 1037251290 8:16897546-16897568 CACAGTTTGTTGAAGAGCTGGGG No data
1037251283_1037251288 23 Left 1037251283 8:16897498-16897520 CCATGTTTCATCTGGGGTTAAAG No data
Right 1037251288 8:16897544-16897566 AACACAGTTTGTTGAAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037251283 Original CRISPR CTTTAACCCCAGATGAAACA TGG (reversed) Intergenic
No off target data available for this crispr