ID: 1037252636

View in Genome Browser
Species Human (GRCh38)
Location 8:16914791-16914813
Sequence GTCCTTGTGGACCTCAGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037252636_1037252641 25 Left 1037252636 8:16914791-16914813 CCAACCCTGAGGTCCACAAGGAC No data
Right 1037252641 8:16914839-16914861 TCCATGCTCTGGTTCAGAAATGG No data
1037252636_1037252640 14 Left 1037252636 8:16914791-16914813 CCAACCCTGAGGTCCACAAGGAC No data
Right 1037252640 8:16914828-16914850 GCTCTTCTTTTTCCATGCTCTGG No data
1037252636_1037252643 26 Left 1037252636 8:16914791-16914813 CCAACCCTGAGGTCCACAAGGAC No data
Right 1037252643 8:16914840-16914862 CCATGCTCTGGTTCAGAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037252636 Original CRISPR GTCCTTGTGGACCTCAGGGT TGG (reversed) Intergenic
No off target data available for this crispr