ID: 1037254250

View in Genome Browser
Species Human (GRCh38)
Location 8:16934532-16934554
Sequence AGGTAGAACAAAATGGCTAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037254250_1037254258 -7 Left 1037254250 8:16934532-16934554 CCGCTAGCCATTTTGTTCTACCT No data
Right 1037254258 8:16934548-16934570 TCTACCTGCTAGGTGGGGTGGGG No data
1037254250_1037254259 -6 Left 1037254250 8:16934532-16934554 CCGCTAGCCATTTTGTTCTACCT No data
Right 1037254259 8:16934549-16934571 CTACCTGCTAGGTGGGGTGGGGG No data
1037254250_1037254262 29 Left 1037254250 8:16934532-16934554 CCGCTAGCCATTTTGTTCTACCT No data
Right 1037254262 8:16934584-16934606 ACTGGTGAAGTTCACAGTCCAGG No data
1037254250_1037254257 -8 Left 1037254250 8:16934532-16934554 CCGCTAGCCATTTTGTTCTACCT No data
Right 1037254257 8:16934547-16934569 TTCTACCTGCTAGGTGGGGTGGG No data
1037254250_1037254256 -9 Left 1037254250 8:16934532-16934554 CCGCTAGCCATTTTGTTCTACCT No data
Right 1037254256 8:16934546-16934568 GTTCTACCTGCTAGGTGGGGTGG No data
1037254250_1037254261 11 Left 1037254250 8:16934532-16934554 CCGCTAGCCATTTTGTTCTACCT No data
Right 1037254261 8:16934566-16934588 TGGGGGAATATTAGAAGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037254250 Original CRISPR AGGTAGAACAAAATGGCTAG CGG (reversed) Intergenic
No off target data available for this crispr