ID: 1037258254

View in Genome Browser
Species Human (GRCh38)
Location 8:16979475-16979497
Sequence GAAAGGCAGCAGCCCCGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037258254_1037258257 3 Left 1037258254 8:16979475-16979497 CCTGACCGGGGCTGCTGCCTTTC No data
Right 1037258257 8:16979501-16979523 CAGAGATGCCCTGCCCAGAGAGG 0: 479
1: 657
2: 479
3: 561
4: 1274
1037258254_1037258262 26 Left 1037258254 8:16979475-16979497 CCTGACCGGGGCTGCTGCCTTTC No data
Right 1037258262 8:16979524-16979546 AAGAATATAGAGAAGCAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037258254 Original CRISPR GAAAGGCAGCAGCCCCGGTC AGG (reversed) Intergenic
No off target data available for this crispr