ID: 1037258256

View in Genome Browser
Species Human (GRCh38)
Location 8:16979492-16979514
Sequence GCAGGGCATCTCTGAAAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3252
Summary {0: 521, 1: 668, 2: 432, 3: 346, 4: 1285}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037258256_1037258262 9 Left 1037258256 8:16979492-16979514 CCTTTCTTTCAGAGATGCCCTGC 0: 521
1: 668
2: 432
3: 346
4: 1285
Right 1037258262 8:16979524-16979546 AAGAATATAGAGAAGCAGTCTGG No data
1037258256_1037258263 18 Left 1037258256 8:16979492-16979514 CCTTTCTTTCAGAGATGCCCTGC 0: 521
1: 668
2: 432
3: 346
4: 1285
Right 1037258263 8:16979533-16979555 GAGAAGCAGTCTGGCTACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037258256 Original CRISPR GCAGGGCATCTCTGAAAGAA AGG (reversed) Intergenic
Too many off-targets to display for this crispr