ID: 1037258256 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:16979492-16979514 |
| Sequence | GCAGGGCATCTCTGAAAGAA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 3252 | |||
| Summary | {0: 521, 1: 668, 2: 432, 3: 346, 4: 1285} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1037258256_1037258262 | 9 | Left | 1037258256 | 8:16979492-16979514 | CCTTTCTTTCAGAGATGCCCTGC | 0: 521 1: 668 2: 432 3: 346 4: 1285 |
||
| Right | 1037258262 | 8:16979524-16979546 | AAGAATATAGAGAAGCAGTCTGG | No data | ||||
| 1037258256_1037258263 | 18 | Left | 1037258256 | 8:16979492-16979514 | CCTTTCTTTCAGAGATGCCCTGC | 0: 521 1: 668 2: 432 3: 346 4: 1285 |
||
| Right | 1037258263 | 8:16979533-16979555 | GAGAAGCAGTCTGGCTACAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1037258256 | Original CRISPR | GCAGGGCATCTCTGAAAGAA AGG (reversed) | Intergenic | ||
| Too many off-targets to display for this crispr | |||||