ID: 1037258257

View in Genome Browser
Species Human (GRCh38)
Location 8:16979501-16979523
Sequence CAGAGATGCCCTGCCCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3450
Summary {0: 479, 1: 657, 2: 479, 3: 561, 4: 1274}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037258255_1037258257 -2 Left 1037258255 8:16979480-16979502 CCGGGGCTGCTGCCTTTCTTTCA No data
Right 1037258257 8:16979501-16979523 CAGAGATGCCCTGCCCAGAGAGG 0: 479
1: 657
2: 479
3: 561
4: 1274
1037258253_1037258257 4 Left 1037258253 8:16979474-16979496 CCCTGACCGGGGCTGCTGCCTTT No data
Right 1037258257 8:16979501-16979523 CAGAGATGCCCTGCCCAGAGAGG 0: 479
1: 657
2: 479
3: 561
4: 1274
1037258252_1037258257 5 Left 1037258252 8:16979473-16979495 CCCCTGACCGGGGCTGCTGCCTT No data
Right 1037258257 8:16979501-16979523 CAGAGATGCCCTGCCCAGAGAGG 0: 479
1: 657
2: 479
3: 561
4: 1274
1037258254_1037258257 3 Left 1037258254 8:16979475-16979497 CCTGACCGGGGCTGCTGCCTTTC No data
Right 1037258257 8:16979501-16979523 CAGAGATGCCCTGCCCAGAGAGG 0: 479
1: 657
2: 479
3: 561
4: 1274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037258257 Original CRISPR CAGAGATGCCCTGCCCAGAG AGG Intergenic
Too many off-targets to display for this crispr