ID: 1037258259

View in Genome Browser
Species Human (GRCh38)
Location 8:16979510-16979532
Sequence TATATTCTTCCTCTCTGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037258259_1037258266 20 Left 1037258259 8:16979510-16979532 CCTGCCCAGAGAGGAAGAATATA No data
Right 1037258266 8:16979553-16979575 TGGCTTTTCGAAGCTGCGGAGGG No data
1037258259_1037258267 25 Left 1037258259 8:16979510-16979532 CCTGCCCAGAGAGGAAGAATATA No data
Right 1037258267 8:16979558-16979580 TTTCGAAGCTGCGGAGGGCTCGG No data
1037258259_1037258265 19 Left 1037258259 8:16979510-16979532 CCTGCCCAGAGAGGAAGAATATA No data
Right 1037258265 8:16979552-16979574 GTGGCTTTTCGAAGCTGCGGAGG No data
1037258259_1037258263 0 Left 1037258259 8:16979510-16979532 CCTGCCCAGAGAGGAAGAATATA No data
Right 1037258263 8:16979533-16979555 GAGAAGCAGTCTGGCTACAGTGG No data
1037258259_1037258262 -9 Left 1037258259 8:16979510-16979532 CCTGCCCAGAGAGGAAGAATATA No data
Right 1037258262 8:16979524-16979546 AAGAATATAGAGAAGCAGTCTGG No data
1037258259_1037258264 16 Left 1037258259 8:16979510-16979532 CCTGCCCAGAGAGGAAGAATATA No data
Right 1037258264 8:16979549-16979571 ACAGTGGCTTTTCGAAGCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037258259 Original CRISPR TATATTCTTCCTCTCTGGGC AGG (reversed) Intergenic
No off target data available for this crispr