ID: 1037258262

View in Genome Browser
Species Human (GRCh38)
Location 8:16979524-16979546
Sequence AAGAATATAGAGAAGCAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037258252_1037258262 28 Left 1037258252 8:16979473-16979495 CCCCTGACCGGGGCTGCTGCCTT No data
Right 1037258262 8:16979524-16979546 AAGAATATAGAGAAGCAGTCTGG No data
1037258256_1037258262 9 Left 1037258256 8:16979492-16979514 CCTTTCTTTCAGAGATGCCCTGC 0: 521
1: 668
2: 432
3: 346
4: 1285
Right 1037258262 8:16979524-16979546 AAGAATATAGAGAAGCAGTCTGG No data
1037258254_1037258262 26 Left 1037258254 8:16979475-16979497 CCTGACCGGGGCTGCTGCCTTTC No data
Right 1037258262 8:16979524-16979546 AAGAATATAGAGAAGCAGTCTGG No data
1037258259_1037258262 -9 Left 1037258259 8:16979510-16979532 CCTGCCCAGAGAGGAAGAATATA No data
Right 1037258262 8:16979524-16979546 AAGAATATAGAGAAGCAGTCTGG No data
1037258255_1037258262 21 Left 1037258255 8:16979480-16979502 CCGGGGCTGCTGCCTTTCTTTCA No data
Right 1037258262 8:16979524-16979546 AAGAATATAGAGAAGCAGTCTGG No data
1037258258_1037258262 -8 Left 1037258258 8:16979509-16979531 CCCTGCCCAGAGAGGAAGAATAT No data
Right 1037258262 8:16979524-16979546 AAGAATATAGAGAAGCAGTCTGG No data
1037258253_1037258262 27 Left 1037258253 8:16979474-16979496 CCCTGACCGGGGCTGCTGCCTTT No data
Right 1037258262 8:16979524-16979546 AAGAATATAGAGAAGCAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037258262 Original CRISPR AAGAATATAGAGAAGCAGTC TGG Intergenic
No off target data available for this crispr