ID: 1037260434

View in Genome Browser
Species Human (GRCh38)
Location 8:17001822-17001844
Sequence AATAGAGCTGCCGGCGGCGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 52}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037260424_1037260434 25 Left 1037260424 8:17001774-17001796 CCTGCACGCTGCCGTCGGGCAGG 0: 1
1: 0
2: 0
3: 8
4: 79
Right 1037260434 8:17001822-17001844 AATAGAGCTGCCGGCGGCGCAGG 0: 1
1: 0
2: 0
3: 4
4: 52
1037260427_1037260434 14 Left 1037260427 8:17001785-17001807 CCGTCGGGCAGGATCTGCAGGTG 0: 1
1: 0
2: 0
3: 14
4: 167
Right 1037260434 8:17001822-17001844 AATAGAGCTGCCGGCGGCGCAGG 0: 1
1: 0
2: 0
3: 4
4: 52
1037260423_1037260434 26 Left 1037260423 8:17001773-17001795 CCCTGCACGCTGCCGTCGGGCAG 0: 1
1: 0
2: 1
3: 3
4: 74
Right 1037260434 8:17001822-17001844 AATAGAGCTGCCGGCGGCGCAGG 0: 1
1: 0
2: 0
3: 4
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037260434 Original CRISPR AATAGAGCTGCCGGCGGCGC AGG Exonic
901730117 1:11273180-11273202 GAAACAGGTGCCGGCGGCGCGGG - Intergenic
910935100 1:92480854-92480876 AAGCGGGCTGCCGGCGGCGCGGG - Exonic
921411352 1:214839557-214839579 AATAAAGCTGCAGCCGGCTCAGG + Intergenic
922725636 1:227921822-227921844 AATGAAGCTGCCGGCGAGGCAGG - Exonic
1073334700 10:102697462-102697484 AATAGAGCTGCCGGGCGCAGCGG - Intronic
1075024542 10:118974985-118975007 AATTGAGGTGCCGGCAGGGCTGG + Intergenic
1076208732 10:128623875-128623897 AAGAGCCCGGCCGGCGGCGCTGG + Intergenic
1076258663 10:129048768-129048790 AAGAGAGGTGCCGCCGGGGCGGG + Intergenic
1077910590 11:6568813-6568835 CATAGAGCTGCCGGTGTAGCAGG - Exonic
1078168527 11:8911145-8911167 CCTAGCGCTCCCGGCGGCGCCGG - Exonic
1078904379 11:15670847-15670869 AATGGAGCAGCCGCCGGCCCAGG + Intergenic
1080458613 11:32435567-32435589 ATAAGAGGGGCCGGCGGCGCGGG + Exonic
1084495324 11:69500103-69500125 CACAGTGCTGCCGGAGGCGCGGG - Intergenic
1092868694 12:12786911-12786933 AATGGAGAGGCCGGCGGCCCGGG + Exonic
1096105439 12:48994871-48994893 AATTTAGCTGCCGGCTCCGCGGG - Intergenic
1097007831 12:55931792-55931814 AGCAGAGCTGCCGCCGGCGCGGG + Intronic
1097057424 12:56258292-56258314 CATCGAGCTCCCGGCGGCGGCGG + Exonic
1121433377 14:93903065-93903087 AACAGAGCTTCCGGCAGCGATGG - Intergenic
1125459222 15:39892785-39892807 AATCAAGCTGCCGGCAGGGCTGG - Intronic
1129672444 15:77614742-77614764 AGTTGAGCCGCCAGCGGCGCCGG + Exonic
1130970393 15:88727632-88727654 ACTAGAGCTTCCTGTGGCGCTGG + Intergenic
1137744622 16:50811680-50811702 AATAGAGCTTCCGGATGCCCAGG - Intergenic
1141882631 16:86869832-86869854 CGTAGAGGTGACGGCGGCGCAGG + Intergenic
1155971983 18:32092007-32092029 GACAGAGCTGCTGGCGGCGGCGG + Exonic
1162122677 19:8481383-8481405 GATAGAGCGGCTGGCGGCGGTGG + Intronic
1162374457 19:10296494-10296516 AACGGAGCGGGCGGCGGCGCTGG + Exonic
1166706051 19:44908632-44908654 CAAGGAGCTGCAGGCGGCGCAGG + Exonic
1167358734 19:49018910-49018932 GATAGAGCTGGCGGCGGTCCAGG + Intergenic
1167366427 19:49057158-49057180 GATAGAGCTGGCGGCGGTTCAGG + Exonic
1167453307 19:49584907-49584929 AATCAAGCTGCCGGAGGGGCTGG - Intronic
925609788 2:5693139-5693161 AAGAGCGCGGCCGGCGGCGGCGG + Exonic
935046640 2:99489527-99489549 CATGGGGCTGGCGGCGGCGCGGG + Intronic
935265176 2:101387481-101387503 ACTAGCGCTGCTGGCGGCCCCGG - Exonic
947571127 2:231235489-231235511 AATAGAGCAGCAGGCGCCACTGG - Intronic
1170655324 20:18281574-18281596 AATAGAGCAGCCGGGTGCGGTGG + Intergenic
1172890519 20:38260736-38260758 AAGGGAGCCGCGGGCGGCGCGGG + Exonic
1176267793 20:64219861-64219883 CATGGAGCTGCTGGGGGCGCTGG - Exonic
1178300685 21:31450370-31450392 AATAGAGCTACAGGAGGAGCTGG - Intronic
1180087784 21:45515827-45515849 AATTCAGCTGCCTGCGGGGCCGG + Exonic
1183949545 22:41345109-41345131 CATAAAGCTGGCGGGGGCGCTGG - Intronic
1184779608 22:46640506-46640528 AACAGAGCTGCTGGCGTCCCTGG + Intronic
950068032 3:10129115-10129137 AAAAGAGCTGCCGGGCGCGGTGG - Intergenic
973329833 4:48901929-48901951 AATAGAGCTGGGGGAGGCGTGGG + Intronic
981690685 4:147505631-147505653 AAAAAAACTGCCGGCGGGGCAGG - Intronic
1018887402 6:167951563-167951585 GATAGGGCTGCCGTCTGCGCAGG + Exonic
1027263341 7:76480416-76480438 CACAGATCTGCCGGAGGCGCTGG + Exonic
1027314719 7:76978523-76978545 CACAGATCTGCCGGAGGCGCTGG + Intergenic
1032838711 7:135697208-135697230 AAGAGAGCGGCCTGCAGCGCTGG - Intronic
1037260434 8:17001822-17001844 AATAGAGCTGCCGGCGGCGCAGG + Exonic
1039896904 8:41723400-41723422 AATACTGCTGCAGGCGGCTCCGG + Intronic
1041830187 8:62144630-62144652 CATAGCGCTGCCGGCTGCGCGGG + Intergenic
1041839058 8:62248514-62248536 ATTAGGGCGGCCGGCGGCGATGG - Intergenic
1043542604 8:81280506-81280528 TATAAAGCAGCCGCCGGCGCCGG + Exonic
1060982699 9:127802898-127802920 TAGAGCGCTGCCGGGGGCGCCGG + Exonic
1193085912 X:77447851-77447873 AGTAGAGCTGGCGGCGCCGCAGG - Exonic
1202372015 Y:24205270-24205292 AAAAGGGCTGCGGGCGACGCGGG + Intergenic
1202498770 Y:25464846-25464868 AAAAGGGCTGCGGGCGACGCGGG - Intergenic