ID: 1037260577

View in Genome Browser
Species Human (GRCh38)
Location 8:17002584-17002606
Sequence CCAAGGACAACCCCAAAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037260577_1037260584 4 Left 1037260577 8:17002584-17002606 CCCCTCTTTGGGGTTGTCCTTGG No data
Right 1037260584 8:17002611-17002633 GCGGTGATGCTGTTCAGCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037260577 Original CRISPR CCAAGGACAACCCCAAAGAG GGG (reversed) Intergenic
No off target data available for this crispr