ID: 1037260581

View in Genome Browser
Species Human (GRCh38)
Location 8:17002586-17002608
Sequence TCCCAAGGACAACCCCAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037260581_1037260584 2 Left 1037260581 8:17002586-17002608 CCTCTTTGGGGTTGTCCTTGGGA No data
Right 1037260584 8:17002611-17002633 GCGGTGATGCTGTTCAGCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037260581 Original CRISPR TCCCAAGGACAACCCCAAAG AGG (reversed) Intergenic
No off target data available for this crispr